Skip to main content

Table 1 Primer sequences of target genes and candidate reference genes for normalization

From: Selection of reference genes in different myocardial regions of an in vivo ischemia/reperfusion rat model for normalization of antioxidant gene expression

Gene symbol Gene name Accession number Reference Forward primer (5'-3') Reverse primer (5'-3') Amplic on length PCR efficiency(%) Tm (°C)
actb Actin, beta V01217 [49] AAGTCCCTCACCCTCCCAAAAG AAGCAATGCTGTCACCTTCCC 97 106 82.9°C
ywhaz tyrosine 3-monooxygenase/tryptophan 5- monooxygenase activation protein zeta polypetide NM_013011.2 [49] GATGAAGCCATTGCTGAACTTG GTCTCCTTGGGTATCCGATGTC 117 94 77.6°C
rpl13a Ribosomal protein L13A NM_173340 [49] GGATCCCTCCACCCTATGACA CTGGTACTTCCACCCGACCTC 132 104 83.5°C
gapdh glyceraldehyde-3-phosphate dehydrogenase NM_01708   CTACCCACGGCAAGTTCAAC CCAGTAGACTCCACGACATAC 138 102 57°C
gusb Glucuronidase, beta NM_017015   TCACCATCGCCATCAACAACAC GCTTATGTCCTGGACGAAGTAACC 92 94, 9 59°C
hprt Hypoxantine guanine phosphoribosyl transferase NM_012583   CCCAGCGTCGTGATTAGTGATG TTCAGTCCTGTCCATAATCAGTCC 110 104 59°C
tbp TATA box binding protein NM_001004198   CACCGTGAATCTTGGCTGTAAAC CGCAGTTGTTCGTGGCTCTC 124 104 58°C
hmbs Hydroxymethylbilane synthase NM_013168 [50] TCTAGATGGCTCAGATAGCATGCA TGGACCATCTTCTTGCTGAACA 76 95, 8 60°C
Pabpn1 poly(A) binding protein, nuclear 1 116697 http://medgen.ugent.be/rtprimerdb TATGGTGCGACAGCAGAAGA TATGCAAACCCTTTGGGATG 110 95 60°C
MnSod Manganese Superoxide dismutase NM_017051.2   ATCTGAACGTCACCGAGGAG TAGGGCTCAGGTTTGTCCAG 141 96 59°C
Cu.ZnSod Copper-Zinc Superoxide dismutase NM_017050 http://medgen.ugent.be/rtprimerdb CGAGCATGGGTTCCATGTC CTGGACCGCCATGTTTCTTAG 101 96 50°C
txnr1 Thioredoxin reductase 1 NM_031614.2   GGTGAACACATGGAAGAGCA GGACTTAGCGGTCACCTTGA 111 98 60°C
  1. Reference and antioxidant-coding gene primer sequences, original references, amplicon sizes, amplification efficiency values and accession number for the PCR analyses in the present study