Skip to main content

Advertisement

Table 1 Sequences of PCR primers

From: DNA fragments binding CTCF in vitro and in vivo are capable of blocking enhancer activity

Fragment ID Primer ID Sequence
1 1L GTTTGTGACCTGTGCCCTTT
  1R GAGGCCCCGACTCTTAACTC
2 2L AGGTCCCTTCTCTCCCTGCT
3 3L AATGATATTCCTCACGGCACT
4 4L GCTCTGGGAAGAAACCACAG
  4R GCAGGAGCAAGGTGAGATG
5 5L GCTTTCTGACCCGCCTTT
6 6L ATAGAGAAGCAGGGGGTGTG
  6R TGCTGTTCCGTAATAACTTGCT
7 7L CACTAATGAGAGACGCTGAGGA
  7R GCTTCTGGAGGGTGTTTCTG
8 8L CACTTTCTCCCACACTTCCA
  8R CACCGTCCTCTGCCAACT
9 9R AAGGCACTGGCATCCTGTCT
10 10L GTACAGCCCTGGAGCAAGGAC
sns snsL ACTCGCAAACCTCAACACCT
  snsR CAAAACTGGAATGGGGAAGA
Plasmid P1L GGATTTCCAAGTCTCCAGGGGAT
primers P1R ACCTCCCACCGTACACGCCT
Plasmid P2L CCGGACGAACTAAACCTGAC
primers P2R TGTAGGTACTCTGTTCTCACCCTTC