Skip to main content

Advertisement

Table 2 Candidate reference genes tested and primer sequences

From: Validation of a set of reference genes to study response to herbicide stress in grasses

Reference gene1 (accession number) Primer sequences (5'-3')2 Amplicon lenght (bp) Tm (°C) Manual threshold3 PCR efficiency (%) Regression coefficient (R2) Average Cq value
CYC F: AGCTTTGAAGTTGGCAGTAG       
  R: GATCGCGTATTCATGGACTTTAG Discarded (aspecific amplification)    
SPS F: CATTGCAAGAACTATTTGTCACG       
  R: GCAGAGATCAAATGGTTCAAATC       
ACT F: TGTGCTTGACTCTGGTGATG 220 58     
  R: TTCATAATCAAGGGCAACGTAAGC    Discarded (aspecific amplification)  
RUBISCO F: CATTATCAAGAAGGGCAAGATGTG 169 60     
  R: TGTTGTACATCCCTGGAAGTTG       
GAPDH F: GTATTGTTGAGGGACTGATGACC 182 57 0.047 92 0.999 23.31
(JN599100) R: AGTAAGCTTGCCATTGAACTCAG       
TUB F: TACTGTGGTTGAGCCATACAATG 162 60 0.069 98 0.993 23.87
(JN599101) R: GCAGAGATCAAATGGTTCAAATC       
EF1 F: CAAGTACTACTGCACCGTCATTG 199 57 0.025 89 0.984 25.10
(JN599095) R: GATCATCTGCTTCACTCCAAGAG       
UBQ F: GCAAGAAGAAGACCTACACCAAG 225 60 0.054 100 0.991 19.00
(JN599096) R: CCTTCTGGTTGTAGACGTAGGTG       
18S F: GTCCAGACATAGGAAGGATTGAC 245 63 0.052 106 0.995 15.08
(JN599097) R: GAACATCTAAGGGCATCACAGAC       
25S F: GCATGAATGGATTAACGAGATTC 165 63 0.098 95 0.998 17.00
(JN599099) R: GGCTCCCACTTATCCTACAC       
26S F: GATAGCGTACAAGTACCGTGAGG 238 63 0.102 94 0.993 20.45
(JN599098) R: GTTTCGGGTCAAATAGGAAGAAC       
  1. 1CYC cyclophilin, SPS sucrose phosphate synthase, ACT actin, RUBISCO ribulose biphosphate carboxylase, GAPDH glyceraldehyde-3-phosphate dehydrogenase, TUB beta-tubulin, EF1 elongation factor 1α, UBQ ubiquitin, 18S 18S ribosomal RNA (nuclear gene), 25S 25S ribosomal RNA (nuclear gene), 26S 26S ribosomal RNA (mitochondrial gene)
  2. 2F: forward primer and R: reverse primer
  3. 3The threshold for fluorescence detection was set using the logarithmic amplification plot so that it is above the background fluorescence, below the linear region and at the beginning of the region of exponential amplification (i.e. the linear portion of the plot)