Skip to main content

Table 2 Primers used for the reference genes chosen after analysis of Table 1

From: Microarray-based uncovering reference genes for quantitative real time PCR in grapevine under abiotic stress

Probeset ID Name Sense primer Anti-Sense primer pb
VVTU3078_at PADCP 5' ATTCATTAAAGTACCTTTCTTT 3' 5' AACACCCAAAAGATGTCGTA 3' 240
VVTU39962_s_at ubiq 5' CAATTTCCTGAGTTCTACAGTT 3' 5' CCTCATTGTATGACTCCCAGT 3' 229
VVTU15763_at TIF 5' AAAGCAGAAGAAACCAAGATT 3' 5' TTGCCAGTGCCTGTAGTAGCC 3' 206
VVTU3178_at TIF-GTP 5' AGCAGCACAGAATAAGAAACT 3' 5' CCATCAGCCCCAACAAATACC 3' 177
VVTU3027_at VH1-IK 5' CAGGGATTATGATAGTAGGA 3' 5' TTGTTTGGTAGAGGAGGTGG 3' 252
VVTU775_at aladin-related 5' CCTACACTTATTCATCTTCG 3' 5' ACTTGTGGCGGTTGCTCTGC 3' 224
- act 5´ TGGATTCTGATGGTGTGAGTC 3' 5' CAATTTCCCGTTCAGCAGTAGTGG 3' 167
- L2 5' TCTACTTCAACCGATATGC 3' 5' CAACCTGTCCGACTG 3' 196
  1. Probeset ID (of all but act and L2 that were not chosen from the microarray), gene name, sense primer, anti-sense primer and transcript length of the product obtained.