Skip to main content

Table 6 Primers for the putative stress marker genes

From: Microarray-based uncovering reference genes for quantitative real time PCR in grapevine under abiotic stress

Name Sense primer Anti-Sense primer pb
PCO 5' GCGTCTCATTATCGTTGGTTC 3' 5' CAGTGTCCTCGTGGTATCG 3' 233
GalSynt 5' CCAATCCCTTCTGAATACAACC 3' 5' TTTCCCACCATTTCCTCACC 3' 184
BKCoAS 5' TGCGACAAGGGCTTTCATC 3' 5' CAGGCTCCAGATCATACTCAG 3' 245
HSP17 5' AGAAGAAGAGCCAGAAGAGAAG 3' 5' ACACACGAAGCGACCAAG 3' 250
  1. Gene name, sense primer, anti-sense primer and transcript length of the putative stress marker genes retrieved from the microarray analysis [39].