Skip to main content

Advertisement

Table 1 Primers used in genome walking PCR

From: Cloning and expression of an endo-1,4-β-xylanase from the coffee berry borer, Hypothenemus hampei

Primers Sequence (5'-3')
GSP1_XIL_GW1_3 CCAATTCATGGAGTCGGTTTCCAATCTCAT
GSP1_XIL_GW1_5 TTCGTTGAAGATTTCGTTGACTACATCCCA
GSP2_XIL_GW1_3 GTTGATGTGGCCATTACTGAATTGGACATC
GSP2_XIL_GW1_5 GGCGTCCCATTTCATTTCATTTTCTGGTGT
GSP1_XIL_GW2_3 GATTTAGCAATTCCCGAATGATGTTCACAC
GSP1_XIL_GW2_5 CCAAGTACTTTGGCCCAGTAAACACGAAAA
GSP2_XIL_GW2_3 CAAACAGTTACACGCCGGGGTAACTCCCAT
GSP2_XIL_GW2_5 CACGGAAGCGTTTTCGAGATATGAATG
GSP1_XIL_GW3_3 CGGAATGCGATAGAAAGGGATGGTTAAC
GSP1_XIL_GW3_5 TCAAGTGTTCCCTATCAGGAAATTGAC
GSP2_XIL_GW3_3 GTCGTCATTTATAGTCTTCCCTGAAGTTG
GSP2_XIL_GW3_5 CTAGTTCGTCAACTGCACAATGCCTGT