Skip to main content

Table 1 Primers and PCR conditions

From: DSCR9 gene simultaneous expression in placental, testicular and renal tissues from baboon (papio hamadryas)

Oligo name Oligo sequence Orientation Primer set Substrate to PCR Initial denatur alization Amplification program Cycles Final elongation Amplicon size
Denaturalization Alignment Elongation
OLIGO-rnaF CTTGGCGCTAAGCTGCCGC Forware AMPLICON -mRNA mRNA 94°/3.5 min 94°/30 seg 60°/45 seg 72°/30 seg 42 72°/15 min 726 pb
OLIGO-rnaR CCTGCTCTGGAGTCTTGGTG Reverse          
OLIGO-gene1F AGCTGGCACTCCCCAGAAT Forware OLIGO-gene1 gDNA 94°/5 min 94°/1 min 60°/45 seg 72°/1 min 35 72°/10 min 946 pb
OLIGO-gene1R GGCTGAGGCACAGAGAAACT Reverse          
OLIGO-gene2F CTCCCTACCAAAGTGGCTAG Forware OLIGO-gene2 gDNA 94°/5 min 94°/1 min 60°/45 seg 72°/35 seg 30 72°/10 min 769 pb
OLIGO-gene2R TGTGGAAAGTTGGGGTTTTC Reverse          
OLIGO-gene3F GAAAACCCCAACTTTCCACA Forware OLIGO-gene3 gDNA 94°/5 min 94°/1 min 60°/45 seg 72°/30 seg 30 72°/10 min 723 pb
OLIGO-gene3R CCAGGCGAGCAGTCTGTAAC Reverse          
OLIGO-gene4F CCTCTCCTGCAACCAATCAG Forware OLIGO-gene4 gDNA 94°/5 min 94°/1 min 60°/45 seg 72°/45 seg 30 72°/10 min 807 pb
OLIGO-gene4R CCCGAATATCCTGGGCTCT Reverse          
OLIGO-gene5F CCGGAAGAGCCCAGGATA Forware OLIGO-gene5 94°/5 min 94°/1 min 60°/45 seg 72°/1 min gDNA 35 72°/10 min 967 pb
OLIGO-gene5R CCGTTTTGGCAGGAATACAT Reverse