Skip to main content

Table 1 - Nucleotide Sequences of Oligonucleotides used for PCR Amplification

From: URPD: a specific product primer design tool

Species ID Primers Nucleotide sequence (5’-3’) Primer length (bps) Tm (°C) GC% PCR targets Size (bp)
ATCC 19606 bla OXA212F GTGCTTCGACCGAGTATG 18 45.68 55.56 blaOXA resistance gene 496
  bla OXA707R ACAACCATCCAGTTAACC 18 41.12 44.44   
ATCC 19606 bla OXA274F GAGCACCATAAGGCAACC 18 45.68 55.56 blaOXA resistance gene 451
  bla OXA724R TATTCCCTTGAGGCTGAAC 19 44.32 47.37   
ATCC 6538p pbp 514F ATGCTTTACGACAAAGTTTC 20 41.25 35.00 penicillin-binding protein 330
  pbp 843R TCTCAGCTAACATGTATGC 19 42.17 42.11   
  1. The primers designed using accession number HQ425495.1 and AF540028.1 for blaOXA and pbp, respectively. F and R under the primers field represent forward primer and reverse primer, respectively. The number under the primers field represents the exact placement of the primer within the target sequence, e.g., the 212 F represents that the forward primer has the exact placement of 212 within the target sequence.