Skip to main content

Table 1 Characteristics of the designed primers specific for Rosaceae PAs biosynthesis genes used in this study

From: Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

Gene name Primer Primer sequence (5' → 3') Tm°Ca
ANR ANRFwd1 CCCACCTMACAGCACTACAA b 53.8
ANRRev1 TACCGACCAGAAGCAGATTC 51.8
ANRFwd2 GGAGTGATTTGGAGTTCTTG 49.7
ANRRev2 GGAAAATCTCCAAACTCAGT 47.7
ANS ANSFwd1 TTTGAYCTTCCCATTGAGCA 49.7
ANSRev1 GCATTTTGGGTAGTAGTTGA 47.7
ANSFwd2 CAGCTTGAGTGGGAGGAYTA 53.8
ANSRev2 GCAGGCCRGGAACCATGTTG 57.9
4-CL 4-CLFwd1 CCTGGAGAGATTTGCATCAG 51.8
4-CLRev1 AATACTCGATTTATTCTTTTATA 42.8
4-CLFwd2 ATCATGAAAGGTTAYCTTAATG 45.5
4-CLRev2 GGAATGGCTTCGATGAAAAA 47.7
CHI CHIFwd1 AGGGGGTYGGAGATTCAGGG 55.9
CHIRev1 GGGAAGKTTTGATCYTTGAA 45.6
CHIFwd2 TTCGTGAAGTTCACGGCGAT 51.8
CHIRev2 TGGGAAGGTCTGATCTTTGA 49.7
C4H C4HFwd1 CTCCGYATGGGRCAGCGCAA 60
C4HRev1 TTGTTGTACATCATMAGCTG 47.7
C4HFwd2 CAGCTBATGATGTACAACAA 47.7
C4HRev2 TGGATTTCRGGGTGGTTCAC 53.8
CHS CHSFwd1 AAGGCCATYAAGGAATGGGG 53.8
CHSRev1 AATGTRAGCCCDACTTCACG 53.8
CHSFwd2 AAGGAATGGGGHCAGCCCAA 55.9
CHSRev2 CTCACYTCRTCCAAAATAAA 47.7
DFR DFRFwd1 CCTGACGCTGTGGAAGGCGG 60
DFRRev1 TAATGGTRATGAAATCAATG 43.6
DFRFwd2 TGCASCGGAGTGTTYCATGT 53.8
DFRRev2 TGAGGCTTGGTGGCATRGATGG 58.6
LAR LARFwd1 GTTCGTMGCYGAAGCCAGCC 60
LARRev1 TGGAACYGATCCAACGGTGG 55.9
LARFwd2 AGGGCYRATCCGGTKGAACC 60
LARRev2 AGGGTSCGRCCAATTTTCTT 51.8
F3H F3HFwd1 GACATGTCCGGYGGCAAAAAGGG 60.6
F3HRev1 CTCATCTTCTTCTTGTACAT 45.6
F3HFwd2 ACGTGGATCACCGTTCAACC 53.8
F3HRev2 GGTTGAACGGTGATCCACGT 53.8
PAL PALFwd1 ATCGATGTTTCRAGGAACAA 47.7
PALRev1 AAAGAGTTAACATCTTGGTT 43.6
PALRev2 AAAAATGTRGAAGACATGAG 45.6
  1. a Melting temperature.
  2. b Degenerate nucleotides codes where B (C/G/T), D (A/G/T), H (A/C/T), K (G/T), M (A/C), N (A/C/G/T), R (A/G), S (G/C), V (A/C/G), W (A/T), Y (C/T).