Skip to main content

Table 3 Primers used in this study

From: Diverse modulation of spa transcription by cell wall active antibiotics in Staphylococcus aureus

Primer name Sequence References
rnaIII- F GCACTGAGTCCAAGGAAACTAAC This study
rnaIII- R AAGCCATCCCAACTTAATAACC This study
spa-F CAAACGGCACTACTGCTGAC This study
spa-R CATGGTTTGCTGGTTGCTTC This study
pyk-F AGGTTGAACTCCCCAAACAA This study
pyk-R GCAGCCCAAGATTACAAAAA This study
  1. (+) up regulation, (−) down regulation of the given promoter::lacZ fusion.