Skip to main content

Table 2 Characterization of the STR primer sequence, fluorescent dye used, size range, chromosome location and reference

From: Microsatellite markers for identification and parentage analysis in the European wild boar (Sus scrofa)

  Locus Primer Sequence (5'-3') Dye Size Range Chr. Reference
Plex1 Sw24 F: CTTTGGGTGGAGTGTGTGC FAM 113-137 17 [14]
   R: ATCCAAATGCTGCAAGCG     
  S0155 F: TGTTCTCTGTTTCTCCTCTGTTTG NED 167-183 1 [15]
   R: AAAGTGGAAAGAGTCAATGGCTAT     
  Sw936 F: TCTGGAGCTCGCATAAGTGCC PET 115-133 15 [14]
   R: GTGCAAGTACACATGCAGGG     
  Sw2410 F: ATTTGCCCCCAAGGTATTTC VIC 122-140 A [16]
   R: CAGGGTGTGGAGGGTAGAAG     
  S0005 F: TCCTTCCCTCCTGGTAACTA NED 223-275 5 [16]
   R: GCACTTCCTGATTCTGGGTA     
  Sw632 F: TGGGTTGAAAGATTTCCCAA VIC 177-197 7 [14]
   R: GGAGTCAGTACTTTGGCTTGA     
  Sw857 F: TGAGAGGTCAGTTACAGAAGACC PET 168-178 14 [14]
   R: GATCCTCCTCCAAATCCCAT     
Plex2 S0226 F: GCACTTTTAACTTTCATGATACTCC PET 202-212 2 [17]
   R: GGTTAAACTTTTNCCCCAATACA     
  Sw72 F: ATCAGAACAGTGCGCCGT VIC 119-133 3 [14]
   R: TTTGAAAATGGGGTGTTTCC     
  Sw240 F: AGAAATTAGTGCCTCAAATTGG FAM 112-130 2 [14]
   R: AAACCATTAAGTCCCTAGCAAA     
  S0068 F: AGTGGTCTCTCTCCCTCTTGCT VIC 246-280 13 [18]
   R: CCTTCAACCTTTGAGCAAGAAC     
  S0101 F: GAATGCAAAGAGTTCAGTGTAGG NED 216-238 7 [19]
   R: GTCTCCCTCACACTTACCGCAG     
  Sw122 F: CAAAAAAGGCAAAAGATTGACA PET 127-143 6 [14]
   R: TTGTCTTTTTATTTTGCTTTTGG     
  Sw2008 F: CAGGCCAGAGTAGCGTGC NED 116-122 11 [16]
   R: CAGTCCTCCCAAAAATAACATG