Skip to main content

Table 2 Primers used for confirmation of homozygous lines

From: Analysis of T-DNA alleles of flavonoid biosynthesis genes in Arabidopsis ecotype Columbia

Allele Primer sequence (5'-3)  
CHS: tt4-13 Intact Gene GATCACTCATGTCGTCTTCTG
(SALK_020583)   AGGGCCAGGCGGTGAAG
  T-DNA insertion GATCACTCATGTCGTCTTCTG
   TTAGAGAGGAACGCTGTGC
CHI: tt5-2 Intact Gene ATGTCTTCATCCAACGCCTG
(CS300857)   GTTCTCTTTGGCTAGTTTTTC
  T-DNA insertion ATGTCTTCATCCAACGCCTG
CHI: tt5-3 Intact Gene CGAAAGTAAGAATTAGAGAATAC
(SALK_034145)   AGGGCCAGGCGGTGAAG
  T-DNA insertion CGAAAGTAAGAATTAGAGAATAC TGATAAACTTCTCAAACGCAC
F3H: tt6-3 Intact Gene TGGTAGGTAGCTAGCGAC
(SALK_113904)   AACACACCGCGCCTAGC
  T-DNA insertion TGGTAGGTAGCTAGCGAC
   AGGGCCAGGCGGTGAAG
F3H: tt7-5 Intact Gene CAGCGGATTGGAATTTGAAC
(SALK_053394)   CAGCTGTGAACATGTTCTG
  T-DNA insertion GGACCGCTTGCTGCAACT
   CAGCTGTGAACATGTTCTG
ANS: tt11-11 Intact Gene AGAGTTGAGAGTCTAGC
(SALK_073183)   GCAAAAGTCCGTGGAG
  T-DNA insertion AGAGTTGAGAGTCTAGC
   TGGTTCACGTAGTGGGCCATCG
ANR: ban-4 Intact Gene TGGACCAGACTCTTAC
(SALK_040250)   AGACCGGTCACATGC
  T-DNA insertion AGACCGGTCACATGC
   TGGTTCACGTAGTGGGCCATCG