From: DICER1 RNase IIIb domain mutations are infrequent in testicular germ cell tumours
Genomic region covered* | Forward primer (5′-3′) | Reverse primer (5′-3′) | Product size | Comment^ |
---|---|---|---|---|
chr14:95560431-95560500 | GGTGCTTGGTTATGAGGTAGTCC | CCCTCAGATTGTTACCAGCG | 70 bp | Product includes codons 1705–1709 of DICER1; primer sequences from this study |
chr14:95557604-95557671 | CATGTAAATGGCACCAGCAA | AAGAGGATATTGAAGTTCCAAAGG | 68 bp | Product includes codons 1810–1813 of DICER1; primer sequences from this study |
chr14:95560345-95560533 | CTTCTGCACAAGCTTACGGTTCCA | CAGCGATGCAAAGATGGTGTTGT | 188 bp | Product includes codons 1705–1709 of DICER1; primer sequences from[10]. |
chr14:95557565-95557759 | TGGACTGCCTGTAAAAGTGG | ACACACCTGCCAGACTGTCTCC | 194 bp | Product includes codons 1810–1813 of DICER1; primer sequences from[10]. |