Skip to main content

Table 2 PCR amplification primers used in this study

From: DICER1 RNase IIIb domain mutations are infrequent in testicular germ cell tumours

Genomic region covered* Forward primer (5′-3′) Reverse primer (5′-3′) Product size Comment^
chr14:95560431-95560500 GGTGCTTGGTTATGAGGTAGTCC CCCTCAGATTGTTACCAGCG 70 bp Product includes codons 1705–1709 of DICER1; primer sequences from this study
chr14:95557604-95557671 CATGTAAATGGCACCAGCAA AAGAGGATATTGAAGTTCCAAAGG 68 bp Product includes codons 1810–1813 of DICER1; primer sequences from this study
chr14:95560345-95560533 CTTCTGCACAAGCTTACGGTTCCA CAGCGATGCAAAGATGGTGTTGT 188 bp Product includes codons 1705–1709 of DICER1; primer sequences from[10].
chr14:95557565-95557759 TGGACTGCCTGTAAAAGTGG ACACACCTGCCAGACTGTCTCC 194 bp Product includes codons 1810–1813 of DICER1; primer sequences from[10].
  1. * Genomic location is based on reference sequence hg19.
  2. ^ Amino acid numbering is based on DICER1 reference sequence [GenBank:NM_177438].