Skip to main content

Table 1 Oligonucleotide primers used in this study

From: Expression analysis of calmodulin and calmodulin-like genes from rice, Oryza sativa L.

Primer name Sequence Positiona Amplicon size (bp)b Annealing temp. (°C)
OsCam1-1-F 5- ACCGTGCATTGCCGTATTAG -3 499-518 177 58.3
OsCam1-1-R 5- GCAAGCCTTAACAGATTCAC -3 656-675
OsCML1-F 5- CCAGAAGTGCGTGATCCTGT -3 543-562 184 58.3
OsCML1-R 5- ACTACGGACTACGGCTGTGA -3 707-726
OsCML3-F 5- ACTACAACGAGTTCCTCAAG -3 410-429 180 57.3
OsCML3-R 5- CATCAGAACAGTTGCAAACC -3 570-589
OsCML4-F 5- GCAGGTGAACTACGATGAAT -3 402-421 193 56.3
OsCML4-R 5- TACCCATAGCTGAAGTCCAA -3 575-594
OsCML5-F 5- ATGATGCTCTCCGACCAATA -3 481-500 180 57.3
OsCML5-R 5- CCAAGGCCAAATTAAATGAC -3 641-660
OsCML7-F 5- CCGCATCGTCGCCAAATAAT -3 429-448 193 57.3
OsCML7-R 5- GTCCAAATCACACCGGAATG -3 602-621
OsCML8-F 5- AGATGATGAAGAGGATAGGA -3 539-555 185 56.3
OsCML8-R 5- AAACATAAGGCGGTATGGTA -3 701-720
OsCML9-F 5- TACAAGGAGTTCGTCAAGGT -3 430-449 170 58.3
OsCML9-R 5- GATTCGCTTGAATCATATCGC -3 579-600
OsCML11-F 5- CAACATCTTCTCCTGAGAAT -3 621-640 183 56.3
OsCML11-R 5- ATTCACAAGAGCTCGATCAC -3 784-803
OsCML13-F 5- ATCGAAATGGTGATGGTGAG -3 437-456 193 58.3
OsCML13-R 5- GCATGGTTGTTCTTGTTCAG -3 610-629
OsEF1α- F 5- ATGGTTGTGGAGACCTTC -3 1192-1209 127 58.3
OsEF1α- R 5- TCACCTTGGCACCGGTTG -3 1301-1318
  1. aPosition of the primers from the GenBank sequence given in the materials and methods, where position 1 is the predicted open reading frame start codon and numbered 5 to 3 on the sense strand.
  2. bExpected amplicon size based upon the primer positions on the GenBank sequence.