Skip to main content

Advertisement

Table 1 Sequences of the primers used

From: Antisense sequencing improves the accuracy and precision of A-to-I editing measurements using the peak height ratio method

Primer Name Sequence
Dα6ORF-F CACGCGATACAAACAAGCCAAGGACA
Dα6ORF-R ACGATTATGTGCGGAGCGGAGAG
DmelActinF ACTCCGGCGATGGTGTCTCC
DmelActinR GGGCGGTGATCTCCTTCTGC
T7 TAATACGACTCACTATAGGG
SP6 TATTTAGGTGACACTATAG
Dα6R CCAGGGCAGCCATTGTAGGAAAAC
Dα6IR2 GCAGCAGGCGTAGACTATCGTATT
Dα6285F AACGGAATACGGCGGGGTCAAG
Dα6ORF-F3 GCGCCTGCTGAACCATCTGC
Dα6ORF-R3 ACCACCGACGAGGGCGACCAT