Skip to main content

Advertisement

Table 5 Identical anti-CCHF aptamer sequences (without flanking primer sequences)

From: Development, screening, and analysis of DNA aptamer libraries potentially useful for diagnosis and passive immunity of arboviruses

Aptamer Sequence
E7c - 23/25R ACAGTTAGAGCTTGCCGTATGCCTTTGTTAACATAA
Gn6 - 25R ACAGTTAGAGCTTGCCGTATGCCTTTGTTAACATAA
E7a - 2/6/28/30bR ACTAACCGAATGGCAGTTTCCCCCTTATCCATCTAT
E7c - 1a/18/20R ACTAACCGAATGGCAGTTTCCCCCTTATCCATCTAT
Gn6 - 11R ACTAACCGAATGGCAGTTTCCCCCTTATCCATCTAT
E7a – 15R GGGATAGGGTCTCGTGCTAGATG
E7b - 13/15R GGGATAGGGTCTCGTGCTAGATG
E7a - 8R CGCTGAAGCAAGACATTATCGGGACATTGCCGTGA
E7b - 20/21R CGCTGAAGCAAGACATTATCGGGACATTGCCGTGA
IbAr 10200 – 2-6/8-11/13-23/25R TGACACGCGTACGGGTCCGGACATGTC ATAACGGAC
E7a – 3/10/16/19/21/22R TGACACGCGTACGGGTCCGGACATGTC ATAACGGAC
E7b – 8a/10/16-19/23-25R TGACACGCGTACGGGTCCGGACATGTC ATAACGGAC
  1. Note: The complementary Forward (F) sequences also match, but were not included for brevity.