Skip to main content


Table 3 Gene identification and primers sequences used in the qPCR analyses

From: Validation of reference genes from Eucalyptus spp. under different stress conditions

Gene Primer   Primer sequence (5’-3’) Amplicon (bp)* Amplification efficiency (%)**
Elongation factor-1α Forward CCTGTCCTTGATTGTCACACTTCC 130 110
Ubiquitin (E. gobulus) Forward TCCGTCAAAAGCGAACAGA 173 97
Ubiquitin (E. urograndis) Forward GGACTTTCGTTCGTTTTGGT 107 97
Isocitrate dehydrogenase-NADP Forward AGTTTGAGGCTGCTGGAATC 100 103
α-Tubulin Forward CCAGTGAACAAATGCCCTCT 92 107
Ribossomal 18S Forward CATGGCCGTTCTTAGTTGGT 71 95
β-Tubulin Forward GATGGGGACGCTATTGATTT 225 100
  1. * Melting temperature = 60°C for all primers. **E=10^(-1/slope)-1.