Skip to main content

Table 1 In silico analysis of primer specificity of the primers used in this study

From: In silico vs in vitro analysis of primer specificity for the detection of Gardnerella vaginalis, Atopobium vaginae and Lactobacillus spp.

Target Probe   Sequence (5′ → 3′) No. of target strains detecteda Sensitivity (%)b No. of non-target strains detecteda Specificity (%)b Reference
G. vaginalis Gard154-454 Fw CTCTTGGAAACGGGTGGTAA 36 (from 40) 90 1 (from 1032184) 100 This study
   Rv TTGCTCCCAATCAAAAGCGGT 38 (from 40) 95 94 (from 1032184) 99,99  
  GV1 + 3 Fw TTACTGGTGTATCACTGTAAGG      [15]
   Rv CCGTCACAGGCTGAACAGT      
  Gv1 + 2 Fw TCCTGTCTACCAAGGCATCC      [13]
   Rv CGTGTGATAACCGTCAGGTG      
A. vaginae Atop109-329 Fw GAGTAACACGTGGGCAACCT 457 (from 467) 97,86 18390 (from 1031757) 98,22 This study
   Rv CCGTGTCTCAGTCCCAATCT 449 (from 467) 96,15 1356 (from 1031757) 99,87  
  AtovagRT3 Fw GGTGAAGCAGTGGAAACACT 134 (from 467) 28,69 0 (from 1031757) 100 [11]
   Rv ATTCGCTTCTGCTCGCGCA 109 (from 467) 23,34 2 (from 1031757) 100  
  Atop167-587 Fw GCGAATATGGGAAAGCTCCG 117 (from 467) 25,05 0 (from 1031757) 100 [10]
   Rv TCATGGCCCAGAAGACCGCC 115 (from 467) 24,63 0 (from 1031757) 100  
Lactobacillus spp. AM Lacto Fw TGATGCATAGCCGAGTTGAG 7353 (from 12936) 56,84 2513 (from 1019288) 99,75 This study
   Rv AGCCGAAACCCTTCTTCACT 5858 (from 12936) 45,28 1027 (from 1019288) 99,9  
  New Lacto Fw TGGAAACAGRTGCTAATACCG 11680 (from 12936) 90,29 7069 (from 1019288) 99,31 [16]
   Rv GTCCATTGTGGAAGATTCCC 10113 (from 12936) 78,18 3311 (from 1019288) 99,68  
  S21 + A19 Fw TGCCTAATACATGCAAGTCGA 9754 (from 12936) 75,4 184796 (from 1019288) 81,87 [17]
   Rv GTTTGGGCCGTGTCTCAGT 10157 (from 12936) 78,52 72659 (from 1019288) 92,87  
  1. Empty boxes correspond to the primers that could not be analysed because there are no databases available to encompass the intergenic region between 16S and 23S rRNA genes for the in silico analysis.
  2. aCalculated using ProbeMatch (last accession, May 2012) with the following data set options: Strain – Both; Source – Both; Size – > 1200 bp; Quality – Both.
  3. aCalculated using ProbeMatch (last accession, May 2012) with the following data set options: Strain – Both; Source – Both; Size – > 1200 bp; Quality – Both.
  4. bFormula: Specificity = (nts/Tnts)*100 (nts: number of non-target strains undetected, Tnts: total number of non-target strains tested).
  5. Sensitivity = (ts/Tts)*100 (ts: number of target strains detected, Tts: total number of target strains tested).