Skip to main content

Table 1 Oligonucleotides used

From: Generation of Trichoderma atroviride mutants with constitutively activated G protein signaling by using geneticin resistance as selection marker

name forward primer (5 to 3) reverse primer (5 to 3)
tga3Phusion ACGTTGGCGGGCTAAGGAGTGAACG CAAACATGCTAAAGAAGAACGATC
pII99 ACTCGTCAAGAAGGCGATAGAAGGC CAAGCAAGGTAAGTGAACGACCCG
tga3Probe GAATCCAAACCTCCTCGTCC GCAGAATCCATCAGGTAAAACTC
tga3PromFw CATCAATCCATCATCAGTCCAAG  
tga3TermRev   CCTCTCTCATTTGCTCAACTC
M13Fw GTTTTCCCAGTCACGAC  
tga3LocusCheck CTTGGAGTCTGCGTGCG  
Mut-tga3 GACTACCAAGCAGAATCCGG TGATTGAACCGCCATAGCAG