Skip to main content

Advertisement

Table 1 Gene target information.

From: Identification and characterization of a salt stress-inducible zinc finger protein from Festuca arundinacea

Name Top Reference Alignment Arabidopsis Homolog Position Forward primer Reverse primer 5'-3' % efficiency
eIF1 ref|XP_478516.1| translational initiation factor eIF1 Oryza sativa AT1G20010 97 GAAGAACGTCTCAAATTTCCTCG CAGTTGCTCAGAAACCATGAATC 99
GST24 ref|XP_463733.1| glutathione S-transferase GST 24 | Oryza sativa AT1G10370 80 AGAAGATCTCACCAACAAGAGC TCGCCGTGGAGGAGAAC 95
Lipoxy-genase L2 ref|XP_469655.1| lipoxygenase L-2; Oryza sativa AT1G72520 361 CACGAGCCTGCCATTGATTA TGTGGTTGTTCTTGACGATGA 98
MAPK1 ref|XP_470659.1| Putative MAP kinase 1 Oryza sativa AT3G45640 148 CCACGGAGAATTTGATAAAGGAAATAC TCCATCAGATTATTCGCTCAAATCAAG 95
FaZnF TIGR Transcript Assembly TA567_4606 Putative Zn finger Festuca arundinacea n/a 632 TGTGCTACCTCACCGTCA TCAGGATGCCCAACAACTAGA 96
GAPDH TIGR Transcript Assembly TA626_4606 Glycerol aldehyde dehydrogenase Festuca arundinacea n/a 951 ATGGGTTATGTTGAGGAGGATT TTGACGAAGTTGTCGTTCAGAG 99
UBC TIGR Transcript Assembly DT703874 Ubiquitin conjugating enzyme Festuca arundinacea n/a 239 CGGCGGCTTCAACTACA CTCGCCAGCATAGAGTG 102
  1. Quantitative PCR primers for each gene and the relative position of the amplicon (center) in the Tall Fescue genes/contigs are indicated. Amplicon length was designed to be between 75-125 bp. Gene target references are also noted along with the PCR efficiency of each primer set. Where applicable, the corresponding Arabidopsis gene reference number of genes found to be up-regulated in Arabidopsis plants overexpressing OsSAP11 [32] are included.