Skip to main content

Advertisement

Table 1 PCR primer sequences

From: A multi-laboratory profile of Mycoplasma contamination in Lawsonia intracellularis cultures

Target gene Primer Nucleotide sequence (5'→3')a Reference
16S rRNA MyU 5-1 CGCCTGAGTAGTACGTTCGC [26]
  MyU 5-2 CGCCTGAGTAGTACGTACGC  
  MyU 5-3 TGCCTGAGTAGTACATTCGC  
  MyU 5-4 TGCCTGGGTAGTACATTCGC  
  MyU 5-5 CGCCTGGGTAGTACATTCGC  
  MyU 5-6 CGCCTGAGTAGTATGCTCGC  
  MyU 3-1b GCGGTGTGTACAAGACCCGA  
  MyU 3-2b GCGGTGTGTACAAAACCCGA  
  MyU 3-3b GCGGTGTGTACAAACCCCGA  
16S and 23S rRNA F1 (OF) ACACCATGGGAGYTGGTAAT [27]
  R1b (OF) CTTCWTCGACTTYCAGACCCAAGGCAT  
  FN2 (IF) ACCTCCTTTCTACGGAGTACAA  
  R2b (IR GCATCCACCAWAWACYCTT  
  FN3 (IF) TATTTGCTATTCAGTTTTCAAAGAAC  
  RN3b (IR) GGGGTGAAGTCGTAACAAGGTAT  
  1. a Abbreviations represent a mixed-base code, which was used to reduce the number of primers. Y = C, T and W = A, T
  2. b Primers are in the reverse orientation