Skip to main content


Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 1 Novel miRviewer identified human mature miRNAs discovered using deep sequencing

From: miRviewer: a multispecies microRNA homologous viewer

miRNA Name Hela SupT1 Total Mature Sequence Seed Conserved Targets Conserved Sites
hsa-miR-365-1* 407 901 1308 ACCGAUUUCAAAUGGUGCUA CCGAUUU 9 9
hsa-miR-652* 180 135 315 GCCCUUUUAACAUUGCACUG CCCUUUU 486 521
hsa-miR-664b 131 98 229 AACACCAUUGUCACACUCCA ACACCAU 195 204
hsa-miR-1249* 1 20 21 GCUGGUAAAAUGGAACCAAA CUGGUAA 146 151
hsa-miR-103-1* 13 4 17 GGCUUCUUUACAGUGCUGCCUUG GCUUCUU 392 412
  1. * refers to the minor miRNA isoform (based on miRbase)