Skip to main content

Advertisement

Table 1 Novel miRviewer identified human mature miRNAs discovered using deep sequencing

From: miRviewer: a multispecies microRNA homologous viewer

miRNA Name Hela SupT1 Total Mature Sequence Seed Conserved Targets Conserved Sites
hsa-miR-365-1* 407 901 1308 ACCGAUUUCAAAUGGUGCUA CCGAUUU 9 9
hsa-miR-652* 180 135 315 GCCCUUUUAACAUUGCACUG CCCUUUU 486 521
hsa-miR-664b 131 98 229 AACACCAUUGUCACACUCCA ACACCAU 195 204
hsa-miR-301a* 79 27 106 CAACCCUAGGAGAGGGUGCCAUUC AACCCUA 70 72
hsa-miR-513a 0 65 65 AGGGGUUCACCGAGCAACAUUCG GGGGUUC 88 110
hsa-miR-128-1* 21 37 58 ACGGGUAUUCUUGGGUGGAUAA CGGGUAU 2 2
hsa-miR-152* 23 0 23 GGAAACAUUUCUGCACAAACUAG GAAACAU 360 375
hsa-miR-1249* 1 20 21 GCUGGUAAAAUGGAACCAAA CUGGUAA 146 151
hsa-miR-103-1* 13 4 17 GGCUUCUUUACAGUGCUGCCUUG GCUUCUU 392 412
hsa-miR-2145 12 4 16 GCGACGAGCCCCUCGCACAAACC CGACGAG 1 1
hsa-miR-107* 1 14 15 AGCUUCUUUACAGUGUUGCCUUG GCUUCUU 392 412
hsa-miR-203* 11 0 11 GUGGAUAUUCCUUCUAUGUUUA UGGAUAU 116 119
  1. * refers to the minor miRNA isoform (based on miRbase)