Skip to main content

Table 2 Primers used in multiplex PCR for SCC mec typing

From: Sccmec type II gene is common among clinical isolates of methicillin-resistant Staphylococcus aureus in Jakarta, Indonesia

Locus Name Oligonecleotide sequence (5’-3) Amplicon size (bp) Specificity ( SCCmec type)
A CIF2 F2 TTCGAGTTGCTGATGAAGAAGG 495 I
CIF2 R2 ATTTACCACAAGGACTACCAGC
B KDP F1 AATCATCTGCCATTGGTGATGC 284 II
KDP R1 CGAATGAAGTGAAAGAAAGTGG
C MECI P2 ATCAAGACTTGCATTCAGGC 209 II, III
MECI P3 GCGGTTTCAATTCACTTGTC
D DCS F2 CATCCTATGATAGCTTGGTC 342 I, II, IV
DCS R1 CTAAATCATAGCCATGACCG
E RIF4 F3 GTGATTGTTCGAGATATGTGG 243 III
RIF4 R9 CGCTTTATCTGTATCTATCGC
F RIF5 F10 TTCTTAAGTACACGCTGAATCG 414 III
RIF5 R13 GTCACAGTAATTCCATCAATGC
G IS431 P4 CAGGTCTCTTCAGATCTACG 381 pUB11C
Pub110 R1 GAGCCATAAACACCAATAGCC
H IS431 P4 CAGGTCTCTTCAGATCTACG 303 III
pT181 R1 GAAGAATGGGGAAAGCTTAC
mecA MECA P4 TCCAGATTACAACTTCACCAGG 162 Positive control
  MECA P7 CCACTTCATATGTTGTAGG