Skip to main content

Advertisement

Table 1 Primer sequences and amplicon characteristics of tested genes

From: Validation of reference genes aiming accurate normalization of qPCR data in soybean upon nematode parasitism and insect attack

Gene symbol Forward primer sequence (5’- 3’) Reverse primer sequence (5’- 3’) Amplicon length (bp) Primer location* Efficiency (%)
GmCYP2 CGGGACCAGTGTGCTTCTTCA CCCCTCCACTACAAAGGCTCG 154 S 98,3
GmELF1A GACCTTCTTCGTTTCTCGCA CGAACCTCTCAATCACACGC 195 D 102,4
GmTUA5 AGGTCGGAAACTCCTGCTGG AAGGTGTTGAAGGCGTCGTG 159 S 101,7
GmELF1B GTTGAAAAGCCAGGGGACA TCTTACCCCTTGAGCGTGG 118 D 92,5
GmACT11 CGGTGGTTCTATCTTGGCATC GTCTTTCGCTTCAATAACCCTA 142 D 104,1
GmUBC2 TCCCCTCACACCCTTCCTC CCATCCCAAGGGGTGTCAT 155 D 107,6
GmTUB CCTCGTTCGAATTCGCTTTTTG CAACTGTCTTGTCGCTTGGCAT 161 S 96,4
GmG6PD ACTCCTTGATACCGTTGTCCAT GTTTGTTATCCGCCTACAGCCT 126 D 110,7
GmUBC4 GAGCGAGCAGTTTCAGAC CATAGGAGGGACGATACG 168 D 98
GmRB7 TTGTAGGTGTCTCCGTCGC AATGCTCTTGGCGGTGATG 179 S 87,3
  1. *Single exon (S) and different exons (D).