Skip to main content

Table 1 Sequences of the primers developed in this study

From: Twenty-one new sequence markers for population genetics, species delimitation and phylogenetics in wall lizards (Podarcis spp.)

Locus name Primer Sequence (5′ - 3′)
Pod6b pod6bf ctggtaatggcccgctatgtatggg
pod6br ataaagctgggaagctcttgagtcc
Pod7b pod7bf gtcactttggtgctgctcgcacagc
pod7br tgtaatgctgcaacttggcgacacc
Pod11 pod11f gactttgggttcaaatctccacccc
pod11r aggtcatctgcttgactgttctggc
Pod12b pod12bf accttcttttgcctacgcacgccag
pod12br ctgtccacaacacccttattctgcc
Pod13 pod13f gcagttgttgctgggctcatttctg
pod13r acatgattttgaggggacgcaaacc
Pod14 pod14f gctttcctatgaggctcaagtttgg
pod14r agccgactgtctctaataacttccc
Pod14b pod14bf ctggaggaagggtagcatgatctcc
pod14br ctgacagccgcatcagacgttcagc
Pod15 pod15f actttacatcccatgataggtctgg
pod15r tgatatagcagaacacctgtgcagc
Pod15b pod15bf aatcctggctaaatgcaagccttgg
pod15br gccaggagaataagctactccatcc
Pod16 pod16f ttcctttgttacaccttgggaggggt
pod16r ctggagagggagcagcggcttcagg
Pod17 pod17f taattgcccattcccttcgattccc
pod17r tgataaccattgccttcattatgcc
Pod20 pod20f gagtgcttacaggctgtgaagatgt
pod20r atgccgattcaaccaaaacatggcg
Pod21 pod21f tctagagaccgagtccttgtaaggg
pod21r gaaactcctctcccagagaacgacc
Pod25 pod25f gtattatcaggcccagtgcttgtgg
pod25r tggtggattatctatcatctgctcc
Pod31 pod31f aacggctatttgcggactacagtag
pod31r gcaggtcactaggaatatagaagcc
Pod33 pod33f atctgatgggagagcattccacagg
pod33r gtgcgccatattacacagcaactgg
Pod38 pod38f agcgctgcaactttctctgcttccg
pod38r gggcatgagtcaggagtagtcacgc
Pod43 pod43f ccattacgtcaagtattgctaatgc
pod43r catagagattcttatgcagaactgg
Pod55 pod55f ggatctttataggagagtgcaggcc
pod55r ttccagattgtgtttatcctggtgg
Pod69 pod69f ttataagtgtgggagtagcgagctg
pod69r ggagcattgaaaatatccaagatgg
Pod72 pod72f gaagggagacggtgtgctattgtcg
  pod72r cctcctgctctctcttcctaacacg