Skip to main content

Advertisement

Table 8 Primers used for real-time PCR expression analysis of six candidate reference genes

From: Selection and validation of reference genes for quantitative gene expression studies by real-time PCR in eggplant (Solanum melongena L)

Name Forward primer 5′-3′ Reverse primer 5′-3′ Length (bp) Tm (°C)
18S rRNA CGCGCGCTACACTGATGTATTCAA TACAAAGGGCAGGGACGTAGTCAA 172 60
APRT GAGATGCATGTAGGTGCTGTGCAA GGCCCTTCAATTCTGGCAACTCAA 163 60
GAPDH ATGGCCTTCAGAGTACCAACTGCT GCTTGACCTGCTGTCACCAACAAA 189 60
Cyclophilin GCGCCAAATTCAAGGACGAGAACT ACAGCCTCGGCCTTCTTAATCACA 196 60
Actin TGTGTTGGACTCTGGTGATGGTGT TCACATCCCTGACGATTTCTCGCT 185 60
RuBP TCGAGACTGAGCACGGATTTGTGT TGCACTCTCCGACCTCATTCAACA 141 60