Skip to main content

Table 1 Characterization of nine microsatellite loci isolated from Atta laevigata

From: Microsatellite loci characterized in the leaf-cutter ant Atta laevigata

Locus Primer sequence (5'-3', forward / reverse) Annealing (°C) Repeat motif N n a Size (bp) H o H e HW p- value
Alae2 AGTTTCTGCAATATTCGC / TCTGTGAGAGAGCAAGTGAG 49.0 (TC) 1(TCC) 2(TC) 9tt(TC) 4 25 8 82-98 0.96 0.81 0.4407
Alae5 GCAAAGACATCGTAAAGTG / TGCAACCGTCTTGTATG 52.0 (TAA) 5 27 2 128-137 0.07 0.07 1.0000
Alae9 TCTTGTAAGTAACTGTCGAGC / CGTCATATCCGAATGTCAG 45.0 (CT)t(CT)23 24 11 124-168 0.96 0.88 0.8732
Alae10 CGCTACATCCCATCTCAC / GACAGCAATATTTCGATAGC 44.0 (GA) 19ca(GA) 27 9 110-130 0.78 0.84 0.0745
Alae11 CACGATAGTTTTCGATATCC / TGGGTGTATCAAAGAAAGAC 45.0 (GA) 15 26 10 100-128 0.58 0.65 0.3458
Alae16 ACTATGTCCATGTTATGCG / GACTACAAGTAAGAATAGTGAGC 56.0 (TC)3tg(TC)3tg(TC)13tg(TC)3tt(TC)7 25 7 188 -212 0.72 0.87 0.0145
Alae18 ACATGTCCACTCCGTCAG / CGATAGCGTGATATTTGC 56.0 (TG)11 22 16 144-188 0.32 0.94 0.0000*
Alae19 GACGTGGAGCTGCAATAC / AAGTGAGTACAAAACATACAGG 50.0 (CAAA)5 22 2 89-93 0.32 0.33 1.0000
Alae24 GCAATAAATTCAGATGGC / CTGCAAAATCACAGTTGC 52.8 (CT)20 25 10 169-191 0.72 0.87 0.1904
  1. Number of individuals (N), number of alleles (n a ), observed (H o ) and expected (H e ) heterozygosities, p-values of Hardy-Weinberg test (HW p-value) based on a sample of 36 individuals (* p-value < 0.00635, following Bonferroni correction). Given the low amount of DNA from some samples, not all 36 individuals were tested for all primers, although all tested individuals amplified for all loci tested.