Skip to main content

Table 4 Guinea pig reference and target gene information

From: The impact of reference gene selection in quantification of gene expression levels in guinea pig cervical tissues and cells

Gene symbol Name Primer sequences 5’ to 3’ Exons Amplicon size (bp) Function Ensembl or GenBank accession no.
Sense and antisense
ACTB β-Actin tgcgttacaccctttcttgaca 5 73 Cytoskeletal protein From ref. [31]
acaaagccatgccaatctcat
ATP5B ATP synthase, F1 complex β subunit gatcaatttaaaagatgctacctcgaa 5 and 6 68 ATP synthesis DQ403103
caccaggcggttcattcatt
ATP6 Adenosine triphosphatase 6 cccactatgagcagcaactgtaa 1 67 ATP metabolism NC_000884
gaagtgggctagggatgcttt
B2M β2-Microglobulin tggtgcatgctgcctttaca 2 64 Cell surface molecule component NM_001172856
gtgatgtgtgaaactctgcaagaa
CFL1 Cofilin 1 ttccaaggatgccatcaaaaa 3 and 4 65 Actin modification ENSCPOT00000008138
cgtagcaatttgcctgtaattcg
CLTC Clathrin caattcgttttcaggagcatctc 1 and 2 64 Coated vesicle formation protein ENSCPOT00000005567
aagccaatgtttgctgggtta
CTBP1 C-terminal binding protein 1 tctcatcaacgacttcactgtcaa 4 and 5 61 Transcriptional repressor phosphoprotein ENSCPOT00000019529
ggccgtgttcaccaggaa
GAPDH Glyceraldehyde-3-phosphate dehydrogenase tcagagggctccctcaaag 2 70 Glycolytic enzyme From ref. [30]
cgctgttgaagtcacaggac
HMBS Hydroxymethyl-bilane synthase cctgggttggcagaacaga 9 and 10 66 Heme biosynthesis ENSCPOT00000006534
tggcccacagcatacatacag
PPIB Cyclophilin B gggcctaaagtcaccgtcaa 1 and 2 63 Protein folding catalyst ENSCPOT00000000258
ccggcccacatcttcatct
RPLP0 Ribosomal protein, large, P0 atgctgctggccaataaggt 3 and 4 64 Protein synthesis ENSCPOT00000019555
tgacttcacatggtgcaatgg
SDHA Succinate dehydrogenase, subunit A gatgccatccattacatgacaga 4 and 5 67 Citric acid cycle enzyme DQ402978
gcatgccataattttctagctcaa
TBP TATA-binding protein acttgacctaaagacaattgcacttc 5 and 6 65 Transcription factor ENSCPOT00000001200
cagcaaaccgcttgggatta
TFRC Transferrin receptor gaccttccagtcttcggtcatg 8 and 9 68 Iron transport S81327
aaagaagggaacccaggtgtataa
TPT1 Tumor protein, translationally controlled 1 ccttgctaatttcaaaaactatcagttc 4 and 5 67   EU330893
agcaaccatgccatctggat
PTGS2 Cyclooxygenase-2 ctgcgcaatgcaatcatga 3 and 4 67 Prostaglandin synthesis Y07896
agttggtggactgtcgatcaga