Skip to main content

Table 1 Sequences of all the molecules used for the binding assays

From: Validation of miRNA-mRNA interactions by electrophoretic mobility shift assays

Molecule Sequence
miR-224 3′ UUGCCUUGGUGAUCACUGAAC 5′
SLC4A4 3′-UTR 5′ AAGCUUUCUAUUGUGACUUU 3′
anti-miR-224 5′ A*A*C*GGAAC*C*AC*T*AGT*GAC*T*T*G 3′
anti-miR-13MIS 5′ T*T*G*CCT AC*CAC*T*ACAC*T*G*A*A*G 3′
SLC4A4 3′-UTR-MM 5′ AAGCUUUCUAUUCACUGAA U 3′
  1. Sequences of the RNA and DNA molecules used in this study. For antisense oligodeoxynucleotides, phosphorothioate-modified bonds were designed according to the minimal modification criteria [21] and are indicated as *. Mismatch bases are indicated in italics.