Skip to main content

Table 1 List of primers used for each chloroplast and nuclear marker with their chromosome localization, function, amplicon length, primer nucleotide sequences and references

From: The coding region of the UFGT gene is a source of diagnostic SNP markers that allow single-locus DNA genotyping for the assessment of cultivar identity and ancestry in grapevine (Vitis vinifera L.)

Marker Localization Coding region Length (bp) Primer name Primer sequence (5′-3′) Ta (°C) References
rps16 Chloroplast Intron 956 rps_F GTGGTAGAAAGCAACGTGCGACTT 56 [31]
     rps_R TGCGGATTCCTAAGAGCAGCGT   [31]
rp132-tmL Chloroplast Intergenic spacer 1377 trnLUAGR CTGCTTCCTAAGAGCAGCGT 50 [32]
     rpl32_F CAGTTCCAAAAAAACGTACTTC   [32]
trnH-psbA Chloroplast Intergenic spacer 460 psbA3′f GTTATGCATGAACGTAATGCTC 56 [33]
     trnHf CGCATGGTGGATTCACAATCC   [34]
trnT-tmL Chloroplast Intergenic spacer 1016 trnTUGU2F CAAATGCGATGCTCTAACCT 56 [35]
     5′tmLUAAR TCTACCGATTTCGCCATATC   [36]
atpB-rbcL Chloroplast Intergenic spacer 927 atpB-rbcL_F AACACCAGCTTTRAATCCAA 56 [37]
     atpB-rbcL_R ACATCKARKTACKGGACCAATAA   [37]
trnL-trnF Chloroplast Intergenic spacer 406 trnL_UNIE GGTTCAAGTCCCTCTATCCC 50 [36]
     trnL_UNIF ATTTGAACTGGTGACACGAG   [36]
GAI Chromosome 1 Transcription factor for GA 761 GAI_F ATGGATGAGCTTCTGCTGT 50 [27]
     GAI_R TAGAAGTGCATCCTGRAGAAT   [27]
ID04 Chromosome 3 ZIP DNA-binding protein 419 Id04_F CACCAGTCCCTTACCAGTCT 55 [38]
     Id04_R CAGTAGAGGAACACAACTGAG   [38]
IIC08 Chromosome 3 ZINC finger protein 418 IIC08_F CAAGGCCTTCTCTTCGTACC 60 [38]
     IIC08_R AAGAATTCATATCGCCGACC   [38]
ATP Chromosome 7 ATP synthase 800 ATP_F ATGCTGTTCCAGTCCGTTTC 60 -
     ATP_R GGGTCGATGGTGATCTTCT   -
UFGT Chromosome 16 Glucosyltransferase 919 UFGT_F4 ATGTCTCAAACCACCACCAACC 63 -
     UFGT_R3 TGACGGTGCCAAAGCTAATG   -