Figure 1From: Online exercise for the design and simulation of PCR and PCR-RFLP experimentsBasic output of the exercise. During the exercise, PCR amplification is carried out for both problem genomes with primers selected by the users (GGGCGTGATCCATTTTTATG and CTATTTGCGCGTTTTTGACA) for problem gene (ymd A) (1). In the PCR-RFLP exercise, after selection of the restriction endonuclease, different cleavage patterns are expected for amplicons (2), and the bands yielded will be shown in a simulated gel (3).Back to article page