Skip to main content


Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Figure 1 | BMC Research Notes

Figure 1

From: Online exercise for the design and simulation of PCR and PCR-RFLP experiments

Figure 1

Basic output of the exercise. During the exercise, PCR amplification is carried out for both problem genomes with primers selected by the users (GGGCGTGATCCATTTTTATG and CTATTTGCGCGTTTTTGACA) for problem gene (ymd A) (1). In the PCR-RFLP exercise, after selection of the restriction endonuclease, different cleavage patterns are expected for amplicons (2), and the bands yielded will be shown in a simulated gel (3).

Back to article page