Skip to main content

Table 1 Open reading frames and genetic features of L. sanfranciscensis EV3 phage

From: The genome of the Lactobacillus sanfranciscensis temperate phage EV3

Locus tag Putative RBS*and start codon nt orf length (aa) Best hit Best hit EMBL protein name Score
EV3_001 ttacgaaaggaga aattgtatg 136-675 179 Phage terminase L. vaginalis, small subunit ATCC 49540 EEJ41449 1.0E-88
EV3_002 gacagtattgctaatatgctaaatg 650-2590 646 Phage terminase L. vaginalis, large subunit, ATCC 49540 EEJ41450.1 0.0
EV3_003 tgcgataggagg tgattagcaatg 2786-3964 398 Phage portal protein L. vaginalis ATCC 49540 EEJ41452.1 0.0
EV3_004 taaaggagg tgataatgtaaatg 3930-5918 662 phage capsid protein L. vaginalis ATCC 49540 EEJ41453.1 0.0
EV3_005 caaaataaaggagt gataaaatg 5950-6489 179 major tail protein Staph. pseudintermedius HKU10-03 ADV05789.1 1.0E-13
EV3_006 actaagggaga tgagtagcaatg 6509-6814 101 Putative uncharacterized protein L. vaginalis ATCC 49540 EEJ41454.1 6.0E-45
EV3_007 aacaagggtggtgacagccaatg 6808-7176 122 Head-tail joining protein L. vaginalis ATCC 49540 EEJ41455.1 5.0E-155
EV3_008 tgtaaaggagc tgagtggcaatg 7169-7606 145 Head-tail joining protein L. vaginalis ATCC 49540 EEJ41456.1 2.0E-91
EV3_009 aaaggatg ttaaatcatgaaaatg 7603-7992 129 Phage tail protein L. vaginalis ATCC 49540 EEJ41424.2 7.0E-66
EV3_010 ttagaaaagagg aaataatttatg 7996-8763 255 Phage major tail protein L. vaginalis ATCC 49540 EEJ41425.1 1.0E-123
EV3_011 cggccattaaggaga taagtaatg 8873-9283 136 Putative uncharacterized protein L. vaginalis ATCC 49540 EEJ41426.1 9.0E-64
EV3_012 gtcgtaagccaaacgtggctctgatg 9343-9513 56 Putative uncharacterized protein L. vaginalis ATCC 49540 EEJ41427.1 7.0E-22
EV3_013 gaaggaaggagg taactaaatg 9514-13305 1263 Phage minor tail protein L. vaginalis ATCC 49540 EEJ41428.1 0.0
EV3_014 aacttaatggagg tcttgcataatg 13305-14141 278 Putative uncharacterized protein L. saliv arius (strain CECT 5713) ADJ78578.1 3.0E-48
EV3_015 aattttagggagg tgttaatttg 14161-15396 411 Glycosylhydrolase L. plantarum CCC78574.1 4.0E-17
EV3_016 aggaacaagggtgattatttaatg 15396-17177 593 Put. Minor structural protein Leu. kimchii IMSNU 11154 ADG39890.1 3.0E-62
EV3_017 tttgtctaggaagg agaaaaaatg 17190-17726 54 Hypothetical protein No hit -
EV3_018 aaaagttgggagtgattaaaaatg 17729-20134 801 Dextranase L. fermentum phage phiPYB5 ADA798961.1 1.0E-137
EV3_019 atgaaataaaggaga aaataaatg 20212-20721 170 hypothetical protein No hit -
EV3_020 tggagaaaggagg tgatgaaatg 20790-21083 97 Predicted protein P. acidilactici EFA25777.1 2.0E-4
EV3_021 aaagaaacgagtgaacaatatg 21067-21309 80 L. plantarum WCFS1 phage P1 holin, lp0683 F9ULS1 6.0E-68
EV3_022 taccattaatcatcgttgctgaaatg 21383-22429 348 putative endolysin L. vaginalis ATCC 49540 EEJ39754.1 9.0E-70
EV3_023 aaagcagaaagcgaattaatatg 23961-22876c 361 phage integrase L. salivarius ACS-116-V-Col5a EFK79983.1 1.0E-112
EV3_024 atattctaaggaga atggaaaatg 24072-24485c 137 Putative uncharacterized protein L. pentosus MP-10 CCB81756.1 4.0E-14
EV3_025 tagaatacgattggatattgatatg 24478-24795c 110 XRE family transcriptional regulator L. pentosus FR871768 4.0E-23
EV3_026 tatgaaaaggagg aatcaatatg 25072-25263 63 Phage antirepressor L. ruminis ATCC 25644 EFZ34631.1 2.0E-10
EV3_027 agaaaaaagatgattgtcatg 25378-25638 89 Phage protein Listeria monocytogenes FSL N1-017 helix-turn-helix protein EFK40475.1 4.0E-5
EV3_028 tataaggggg tgagatagatg 25639-25794 51 Hypothetical protein No hit -
EV3_29 atttcaaggaga tgtaataaatg 25798-26028 77 Hypothetical protein No hit -
EV3_030 aatctaaaaggaag ttattcatatg 26146-26322 59 hydrolase NUDIX family L. delbrueckii CAI96847 0.73
EV3_031 aattttagtggggg tagagaaatg 26336-26821 161 Putative uncharacterized protein Mahella australiensis DSM 15567 AEE95754.1 6.0E-7
EV3_032 ccgaaaggaag tgagataaatg 26852-27319 155 Putative uncharacterized protein lp_0862 L. pentosus IG1 FR874854.1 1.0E-22
EV3_033 actaaattataggaga taaatatg 27380-28120 246 NTP-binding protein L. paracasei subsp. paracasei ATCC 25302 EEI67797.1 5.0E-71
EV3_034 agtttggaagtgatgaaaacggtg 28068-29459 463 Putative helicase Lactobacilus phage A2 CAB63670.1 1.0E-130
EV3_035 acaaataggaga aaaatattatg 29479-30042 187 Single stranded binding protein L. hilgardii ATCC 8290 EEI25831.1 4.0E-41
EV3_036 aatatatgaaagggaaaatttatg 30115-32442 775 Phage primase, P4 family L. buchneri NRRL B-30929 AEB73788.1 0.0
EV3_037 taattttaaggagg aacacaaatg 32745-33152 135 Hypothetical protein No hit -
EV3_038 atgaaagatgtgatgtctgataatg 33145-33465 106 VRR-NUC domain Phage protein L. plantarum JDM1 ACT61379.1 2.0E-33
EV3_039 tgaatatagtaggag catttaaatg 33462-33686 75 Hypothetical protein No hit -
EV3_040 aagattgggagaaaataaccgtg 33676-33849 58 Hypothetical protein No hit -
EV3_041 caatgtaaggaag aatgataatg 33872-34114 80 Ribonucleoside-diphosphate reductase 2, Ent. faecalis AAO80328.1 3.0E-13
EV3_042 ataatcgtttcgttgggggttattatg 34196-34612 138 Phage transcriptional regulator Lactobacillus phage phig1e CAA66778.1 3.0E-14
EV3_043 taaacaaaaggagt agttaatatg 34666-34833 56 Putative transporter protein L. reuteri ATCC 53608 CCC04545.1 3.0E-14
  1. *Putative ribosomal binding sites are printed in italics.
  2. Putative start codons are printed in bold.