Skip to main content

Table 1 Selected candidate reference genes, primers, and PCR reactions efficiencies

From: Evaluation of suitable reference genes for gene expression studies in porcine PBMCs in response to LPS and LTA

Gene name GenBank accession number Primer sequence (5' → 3') Amplicon length (bp) Amplification efficiency (%) aR2 Average Cq of cDNA (n = 2)
No culture Control LPS LTA Combined
B2M NM_213978 F:ACTTTTCACACCGCTCCAGT R:CGGATGGAACCCAGATACAT 180 89.20 0.992 20.4 ± 0.09 22.0 ± 0.63 32.2 ± 1.41 31.7 ± 1.39 30.38 ± 1.02
BLM NM_001123084 F:TCCTCACCTTCTGCATTTCC R:GTGGTGGCTGAGAATCCTGT 152 93.12 0.993 26.5 ± 0.33 27.2 ± 0.79 35.2 ± 0.60 35.0 ± 0.72 35.7 ± 1.05
GAPDH AF017079 F:ACCCAGAAGACTGTGGATGG R:ACGCCTGCTTCACCACCTTC 247 89.45 0.994 20.9 ± 0.78 23.5 ± 0.99 33.7 ± 0.79 33.5 ± 2.33 33.3 ± 1.34
HPRT1 NM_001032376 F:AACCTTGCTTTCCTTGGTCA R:TCAAGGGCATAGCCTACCAC 150 91.88 0.997 24.7 ± 0.26 26.5 ± 1.01 34.8 ± 1.41 34.3 ± 0.82 34.0 ± 0.57
PPIA NM_214353 F:CACAAACGGTTCCCAGTTTT R:TGTCCACAGTCAGCAATGGT 171 91.32 0.997 19.3 ± 0.19 20.4 ± 0.78 31.0 ± 1.46 31.2 ± 1.29 29.9 ± 0.78
RPL4 DQ845176 F:AGGAGGCTGTTCTGCTTCTG R:TCCAGGGATGTTTCTGAAGG 185 90.21 0.993 19.8 ± 0.47 22.0 ± 0.79 31.9 ± 1.65 32.3 ± 1.67 30.7 ± 1.27
SDHA DQ178128 F:AGAGCCTCAAGTTCGGGAAG R:CAGGAGATCCAAGGCAAAAT 149 92.24 0.996 25.6 ± 0.18 27.4 ± 0.53 34.7 ± 0.80 34.7 ± 0.85 34.7 ± 0.91
TBP DQ178129 F:ACGTTCGGTTTAGGTTGCAG R:GCAGCACAGTACGAGCAACT 118 99.60 0.997 23.8 ± 0.13 24.7 ± 0.66 33.7 ± 2.61 32.4 ± 2.68 32.2 ± 0.45
YWHAZ DQ178130 F:ATTGGGTCTGGCCCTTAACT R:GCGTGCTGTCTTTGTATGACTC 146 94.52 0.994 21.9 ± 0.25 23.9 ± 1.62 32.0 ± 1.29 32.7 ± 1.55 31.4 ± 0.94