Skip to main content

Table 1 Characteristics of nine polymorphic microsatellite loci for Nematocarcinus lanceopes tested on 55 individuals

From: Isolation and characterization of nine polymorphic microsatellite markers for the deep-sea shrimp Nematocarcinus lanceopes (Crustacea: Decapoda: Caridea)

Locus Repeat motif Oligonucleotide primer sequence 5' → 3' Fragment length (bp) NA HO HE FNull Alleles
A06 (AG)25 Fw: GTCCTGAGTAATCGGCTCAGCTCT 187–233 17 0.927 0.924 0
   Rev: ACCCAGTTGGAAGCTGTTCTGAG      
NL37 (AAT)19 Fw: GGGTTTAGGAGGAGTTTCGGGAC 186–228 12 0.782 0.832 0.017
   Rev: ACGAGTTGGAATGGGGCTGATG      
NL16 (AG)12 Fw: TCAATTGTCCGGGACGCAAATGT 150–182 13 0.545 0.549 0
   Rev: AGTACATGGGCCACTAACTCCG      
NL44 (ACAG)11 Fw: AATGGAGTGCAATGACGCTTGG 254–328 12 0.818 0.881 0.026
   Rev: TCGCAGTTTGTTTTAGAGGGAGC      
NL51 (AT)12 Fw: TGATGACAGGGATTTGTCTTTCG 144–166 9 0.727 0.824 0.052
   Rev: TCCCCATTTGTACGCTATCC      
NL53 (AC)11 Fw: ACAGTACACAGGCTACATAC 149–179 14 0.800 0.796 0.001
   Rev: ATCTTCATGTTATGCCCTCTAG      
NL55 (AG)11 Fw: ACGCGAACAGTGCTAAGAAGAC 162–216 25 0.927 0.940 0
   Rev: CACCACAGCAAGGAACCTCC      
NL56 (AG)12 Fw: AGTGAAAAGACTCAAATTCCTTGG 151–201 23 0.764* 0.934 0.077
   Rev: CATTACTGCTTCCTTCCTCTC      
NL49 (AG)11 Fw: ACTCTACTTTGGCTTTCTCCCTC 155–183 11 0.927 0.861 0
   Rev: ACACGGGTCTTCCTGAGTGTTG      
  1. N A number of alleles; H O observed heterozygosity; H E expected heterozygosity; F Null Alleles frequency of null alleles.
  2. * Indicates a locus that deviates from HWE after Bonferroni correction (9 comparisons; significance threshold = 0.005). Forward primers of the loci A06, NL44 and NL55 were labelled with a T7 tail (5’-TAATACGACTCACTATAG-3’) all other forward primers were labelled with a Sp6 tail (5’-GATTTAGGTGACACTAT-3’). A “pigtail” (5’-GTTTCTT-3’) was added to the reverse primers of the loci NL49, NL51, NL53, NL55 and NL56 to reduce stutter bands [16].