Skip to main content

Table 1 Primers used for RT-qPCR in the present study

From: Evaluation of reference genes for reverse transcription quantitative PCR analyses of fish-pathogenic Francisella strains exposed to different growth conditions

     Primer efficiency    
Target gene Forward primer (5- 3) Reverse primer (5- 3) Amplicon size Fn. ssp. noatunensis Fn. ssp. orientalis Gene ID Position
uvrD ACTATTTGTCGCGGGTCCTT TCAAAGAAACGAAAACCTCCA 82 bp 2.050 1.959 12951493 596634-596715
rpoB GTGGTAAAGCGCAATTTGGT CAGCACCATATGCTTGTAACG 72 bp 1.986 1.988 12951517 620011-620082
gyrA CGAGCTTTACGAGCTGCTTC TCTTTTAGAGAACCCTAAAGAGGCT 87 bp 1.982 2.000 12952071 1187616-1187702
polA AGCTGGAACTGGTCGTAATCA ATCAGCATCTTCAGCAGCATA 82 bp 1.959 1.950 12951484 584274-584355
fopA TACTGGTGCATGGGATGTTG TCTTGGAGCCATTGTCTGAA 100 bp 1.902 1.938 12952182 1297252-1297351
ftsZ TACCATACTCAGCGGCTTTC GCGCCTGTAGTTGCTGAAGT 112 bp 1.986 1.997 12952792 136099-136210
ribC ATCTCAACTAGCCACGCTCC CGGTGGACACATGGTACAAG 87 bp 1.946 1.950 12952738 84136-84222
16S rRNA AACGACTGTTAATACCGCATAATATCTG [17] CCTTACCCTACCAACTAGCTAATCCA [17] 101 bp 1.954 1.954 12951375 463870-463970
iglC TAGGCGTATAACACTGGCTGC TGCTATAGAAGGCGGAGAGG 70 bp 2.006 1.905 12951826 930145-930214
  1. The complete genome of F. noatunensis ssp. orientalis strain Toba 04 (Accession number NC_017909), was used as a reference to assign the Gene ID.