Skip to main content

Advertisement

Table 1 A list of primers of 9 candidate house-keeping genes for RT-PCR

From: Validation of reference genes for expression analysis by quantitative real-time PCR in Leptinotarsa decemlineata (Say)

Gene namea Primer sequences (5’to 3’) Amplicon size (bp) Accession no. of homologb
ACT1 Forward GTGAGCAGTGTCCAACCTC 548 XP_966495
  Reverse GGGAAGAGCGTAACCTTCG
ACT2 Forward GAGAAGATGGCGCAGATCATG 720 NP_001165843
  Reverse CCACATCTGTTGGAACGTGG
ARF1 Forward GGGGAGGCAAACCGGTCA 603 XP_973025
  Reverse GGCTTCTAAACCTAGTGCCTGG
ARF4 Forward GGACCTATCTTCAGCTATGCGT 681 XP_970752
  Reverse CAATCCCTCGTGAAGGCCA
EF1α Forward CCTTGTTCTGGGCAAACAGG 192 XP_968773
  Reverse AACCTTGCCCATCAGCAC
RP4 Forward GCACCAGGTCTTGTTCGTG 311 XP_971634
  Reverse GGGGAATACGGGCGACAG
RP18 Forward ACTTCGTGTCACTGAAACTGC 252 XP_968042
  Reverse TATCCGCACGACTTCCTGC
TBP1 Forward ATAACCCTGGCCGTCTCCATG 886 XP_969256
  Reverse TGTACTGTCGCCCGGGTTGAAC
TBP2 Forward TACGAGAACCCCGTACCACT 345 XP_969326
  Reverse GCCTAACTTTGGCACCCGT   
  1. a: ACT1 and ACT2, Actin; ARF1 and ARF4, ADP-ribosylation factor; TBP1 and TBP2, TATA box binding protein; RP4 and RP18, ribosomal protein; EF1α, translation elongation factor 1α. They are named according to the corresponding genes in the T. castaneum genome. b: the accession number of homologs in T. castaneum.