Skip to main content

Advertisement

Table 2 Primers of 9 candidate house-keeping genes used in qRT-PCR

From: Validation of reference genes for expression analysis by quantitative real-time PCR in Leptinotarsa decemlineata (Say)

Gene namea Primer sequenceb Amplicon size (bp) Slopec R2d Efficiencye
ACT1 F-CAAAGCCAACAGGGAGAAGATGAC 105 −3.131 0.991 2.086
R-CGACCAGAAGCGTACAAGGAGAG
ACT2 F- TTCTGATTCCGTGAGGATTTTG 149 −3.313 0.985 2.004
R- GTGAGGTGGATGTTCGTAGGG
ARF1 F- CGGTGCTGGTAAAACGACAA 135 −3.131 0.964 2.086
R- TGACCTCCCAAATCCCAAAC
ARF4 F- GTGCTCGTGAACCATGTGAA 140 −3.130 0.997 2.087
R- AACCTCCAATCCCTCGTGAA
EF1α F- CAGGGCAAGGTTTGAAAGATAA 111 −3.216 0.972 2.046
R- CGTCTGCTTTGCGATTGAG
RP4 F- AAAGAAACGAGCATTGCCCTTCCG 119 −3.317 0.984 2.002
R- TTGTCGCTGACACTGTAGGGTTGA
RP18 F- TAGAATCCTCAAAGCAGGTGGCGA 133 −3.158 0.976 2.073
R- AGCTGGACCAAAGTGTTTCACTGC
TBP1 F- ATGTCAAGCAGAAAGTCAAGAATCC 173 −3.204 0.988 2.054
R- GCCGTAATATCCCTAACTCCCAAG
TBP2 F- AGCGAGGAAGACTCCAGGTTG 171 −3.018 0.957 2.144
  R- ACTACTGAAAGAACTGTGAGTGAGC     
  1. a: ACT1 and ACT2, Actin; ARF1 and ARF4, ADP-ribosylation factor; TBP1 and TBP2, TATA box binding protein; RP4 and RP18, ribosomal protein; EF1α, translation elongation factor 1α. b, Primer sequence of RP4 and RP18 were adopted from Zhu et al. (2011)[29]. c, Slope value of the standard curve. d, Regression coefficient calculated from the regression line of the standard curve. e, Real-time qRT-PCR efficiency calculated by the standard curve method.