Skip to main content

Table 2 Analyzed murine genes and their specific real-time QPCR conditions

From: Ontogeny of adrenal-like glucocorticoid synthesis pathway and of 20α-hydroxysteroid dehydrogenase in the mouse lung

Mouse genes Accession number (NCBI) Oligonucleotides (sense/antisense) Amplicon length (bp) QPCR conditionsa
Ann. T (°C) Acq. T (°C)
Cyp11a1 NM_019779 ATCCGGGCTTCTTTCCCAATC/GGATGGGGTTCTCAGGCATC 249 64 86
Hsd3b1 NM_008293 TGCCAGGGCATCTCTGTTGTC/TCTGTTCCTCGTGGCCATTCA 220 64 84
Cyp21a1 NM_009995 TCACGACTGTGTCCAGGACTTG/TTCGTCTTTGCCATCCCTTTG 250 67 84
Akr1C18 NM_1340662.2 GCACCATAGGCAACCAGAAC/TCTCATTCATTTCCCAGTGTCTC 312 54 78
Cyp11b1 NM_001033229 CTGGGACAGTCCTCAATGTGA/ATCCGCACATCCTCTTTCTCTT 244 62 87
Hsd11b1 NM_008288 GGCCAGCAAAGGGATTGGAAG/TTTTCCCAGCCAAGGAGGAGA 401 66 85
Hsd11b2 NM_008289 TGGCTGACGTGGGACTGTCT/TTGGAGCAGCCAGGCTTGATA 277 63 87
Gapdh NM_008084 GTCGGTGTGAACGGATTTG/AAGATGGTGATGGGCTTCC 215 61 84
Hmbs NM_013551 GGAATGCATGTATGCTGTGGG/CAGGTACAGTTGCCCATCTT 208 59 85
  1. aAnn. T, annealing temperature; Acq. T, acquisition (fluorescence intensity reading) temperature.