Skip to main content

Table 1 Canonical mature miRNAs selected for qPCR validation

From: Analysis options for high-throughput sequencing in miRNA expression profiling

miRNA HTS (A) qPCR target sequence
Abundance class RPM
hsa-miR-27b-5p Low1 (L1) 33 agagcuuagcugauuggugaac
hsa-miR-708-3p Low2 (L2) 26 caacuagacugugagcuucuag
hsa-miR-30e-5p Medium1 (M1) 3639 uguaaacauccuugacuggaag
hsa-miR-146a-5p Medium2 (M2) 1002 ugagaacugaauuccauggguu
hsa-miR-181a-5p High1 (H1) 28011 aacauucaacgcugucggugagu
hsa-miR-143-3p High2 (H2) 36537 ugagaugaagcacuguagcuc