Skip to main content

Table 1 Sequences of primers used in qRT-PCR

From: Relevance of the two-component sensor protein CiaH to acid and oxidative stress responses in Streptococcus pyogenes

Primer Sequence (5-3)
GyrA-1584 F ACGTGGCGTCCAAGGAACT
GyrA-1709R TGCTAAGCTTTCAACCGATAGACA
HtrA-F4 ATCGACGGAGCTAAACGAATTG
HtrA-R4 TCAGCTCCAACTAATTCACCAACA
Nrd-F ACAGTAGACAAGCTGAAGACGGC
Nrd-R AGCGAGTATGACACTGTTCACATTC
Emm1-31 F TGCTACTCCAGCTGTTGCCATA
Emm1-98R ACAGGTGAAACAGCTAACCCATTC
MGAS5005 polA-F GCGGGCAAAACCACCTT
MGAS5005 polA-R GCGCGACCCGCCTTATA
  1. Primers were designed by using Primer Express® software version 3.0 and 2.0, and with technical support of life technologies Japan.