Skip to main content

Advertisement

Table 1 Primer sequence for detection of STEC serotgroups and antibiotic resistance genes

From: Virulence factors, serogroups and antimicrobial resistance properties of Escherichia coli strains in fermented dairy products

Primer name Sequence Size of product (bp) Reference
O26-F (F) CAGAATGGTTATGCTACTGT 423 [34]
O26-R (R) CTTACATTTGTTTTCGGCATC
O103-F (F) TTGGAGCGTTAACTGGACCT 321 [34]
O103-R (R) GCTCCCGAGCACGTATAAG
O111-F (F) TAGAGAAATTATCAAGTTAGTTCC 406 [34]
O111-R (R) ATAGTTATGAACATCTTGTTTAGC
O145-F (F) CCATCAACAGATTTAGGAGTGT 609 [34]
O145-R (R) TTCTACCGCGAATCTATC
O157-F (F) CGGACATCCATGTGATATGG 259 [34]
O157-R (R) TTGCCTATGTACAGCTAATCC
O45-F (F) CCGGGTTTCGATTTGTGAAGGTTG 527 [35]
O45-R (R) CACAACAGCCACTACTAGGCAGAA
O91-F (F) GCTGACCTTCATGATCTGTTGA 291 [36]
O91-R (R) TAATTTAACCCGTAGAATCGCTGC
O113-F (F) GGGTTAGATGGAGCGCTATTGAGA 771 [37]
O113-R (R) AGGTCACCCTCTGAATTATGGCAG
O121-F (F) TGGCTAGTGGCATTCTGATG 322 [38]
O121-R (R) TGATACTTTAGCCGCCCTTG
O128-F (F) GCTTTCTGCCGATATTTGGC 289 [39]
O128-R (R) CCGACGGACTGATGCCGGTGATT
aadA1 (F) TATCCAGCTAAGCGCGAACT 58 [40]
(R) ATTTGCCGACTACCTTGGTC
tetA (F) GGTTCACTCGAACGACGTCA 57 [40]
(R) CTGTCCGACAAGTTGCATGA
tetB (F) CCTCAGCTTCTCAACGCGTG 56 [40]
(R) GCACCTTGCTGATGACTCTT
dfrA1 (F) GGAGTGCCAAAGGTGAACAGC 45 [41]
(R) GAGGCGAAGTCTTGGGTAAAAAC
qnr (F) GGGTATGGATATTATTGATAAAG 50 [20]
(R) CTAATCCGGCAGCACTATTTA
aac (3)-IV (F) CTTCAGGATGGCAAGTTGGT 55 [42]
(R) TCATCTCGTTCTCCGCTCAT
Sul1 (F) TTCGGCATTCTGAATCTCAC 47 [42]
(R) ATGATCTAACCCTCGGTCTC
blaSHV (F) TCGCCTGTGTATTATCTCCC 52 [42]
(R) CGCAGATAAATCACCACAATG
CITM (F) TGGCCAGAACTGACAGGCAAA 47 [42]
(R) TTTCTCCTGAACGTGGCTGGC
ereA (F) GCCGGTGCTCATGAACTTGAG 52 [42]
(R) CGACTCTATTCGATCAGAGGC
cat1 (F) AGTTGCTCAATGTACCTATAACC 55 [42]
(R) TTGTAATTCATTAAGCATTCTGCC
cmlA (F) CCGCCACGGTGTTGTTGTTATC 55 [42]
(R) CACCTTGCCTGCCCATCATTAG