Skip to main content

Table 1 Probe sequences

From: Influence of the length of target DNA overhang proximal to the array surface on discrimination of single-base mismatches on a 25-mer oligonucleotide array

Probe name Sequence (5′ to 3′)
PM 1 ACTACGACACACATGACATGATCAA
5AA 1 ACA ACGACACACATGACATGATCAA
MAA 1 ACTACGACACACAA GACATGATCAA
3AA 1 ACTACGACACACATGACATGAA CAA
5AG 1 ACTAA GACACACATGACATGATCAA
MAG 1 ACTACGACACAA ATGACATGATCAA
3AG 1 ACTACGACACACATGACATGATA AA
5GG 1 ACTAG GACACACATGACATGATCAA
MGG 1 ACTACGACACAG ATGACATGATCAA
3GG 1 ACTACGACACACATGACATGATG AA
5CC 1 ACTACC ACACACATGACATGATCAA
MCC 1 ACTACGACACACATC ACATGATCAA
3CC 1 ACTACGACACACATGACATC ATCAA
5 AC 1 ACTACA ACACACATGACATGATCAA
MAC 1 ACTACGACACACATA ACATGATCAA
3 AC 1 ACTACGACACACATGACATA ATCAA
5CT 1 ACTACT ACACACATGACATGATCAA
MCT 1 ACTACGACACACATT ACATGATCAA
3CT 1 ACTACGACACACATGACATT ATCAA
5TT 1 ACTT CGACACACATGACATGATCAA
MTT 1 ACTACGACACACT TGACATGATCAA
3TT 1 ACTACGACACACATGACATGT TCAA
5GT 1 ACTG CGACACACATGACATGATCAA
MGT 1 ACTACGACACACG TGACATGATCAA
3GT 1 ACTACGACACACATGACATGG TCAA
PM 2 ACGATATCCTCGAAAAGACGATCAA
5AA 2 ACGAA ATCCTCGAAAAGACGATCAA
MAA 2 ACGATATCCA CGAAAAGACGATCAA
3AA 2 ACGATATCCTCGAAAAGACGAA CAA
5AG 2 AA GATATCCTCGAAAAGACGATCAA
MAG 2 ACGATATCCTA GAAAAGACGATCAA
3AG 2 ACGATATCCTCGAAAAGACGATA AA
5GG 2 AG GATATCCTCGAAAAGACGATCAA
MGG 2 ACGATATCCTG GAAAAGACGATCAA
3GG 2 ACGATATCCTCGAAAAGACGATG AA
5CC 2 ACC ATATCCTCGAAAAGACGATCAA
MCC 2 ACGATATCCTCC AAAAGACGATCAA
3CC 2 ACGATATCCTCGAAAAGACC ATCAA
5 AC 2 ACA ATATCCTCGAAAAGACGATCAA
MAC 2 ACGATATCCTCA AAAAGACGATCAA
3 AC 2 ACGATATCCTCGAAAAGACA ATCAA
5CT 2 ACT ATATCCTCGAAAAGACGATCAA
MCT 2 ACGATATCCTCT AAAAGACGATCAA
3CT 2 ACGATATCCTCGAAAAGACT ATCAA
5TT 2 ACGT TATCCTCGAAAAGACGATCAA
MTT 2 ACGATATCCTCGT AAAGACGATCAA
3TT 2 ACGATATCCTCGAAAAGACGT TCAA
5GT 2 ACGG TATCCTCGAAAAGACGATCAA
MGT 2 ACGATATCCTCGG AAAGACGATCAA
3GT 2 ACGATATCCTCGAAAAGACGG TCAA
  1. Mismatched bases are indicated in bold.
\