Skip to main content

Table 2 Primers used for biotin-labelled PCR

From: Influence of the length of target DNA overhang proximal to the array surface on discrimination of single-base mismatches on a 25-mer oligonucleotide array

Forward primer Forward primer sequence (5′ to 3′) Reverse primer Reverse primer sequence (5′ to 3′) Amplicon length (bases) Length of 5′ segment (bases)
for1 CTGGAGGAGCCTTCCCTAC rev1 GTCGCGACTGCCGCTC 94 43
for2 CCTCGCATTGCTCAAGCACA rev1 as above 145 43
for3 CGCGACACGCCCATGT rev1 as above 243 43
for4 GCGGACATCGACGGCTATGT rev1 as above 312 43
for4 lim* AACGCGCGGACATCGACGGCTATGT rev1 as above 317 43
for5 GCGCATACGATTCTTCAAAAGGC rev1 as above 978 43
for3 as above rev2 ACGCCTTACGTATCGGATCG 298 107
for6 CTTCGGGCCACCGCTACTA rev3 TGTGCTGTGGGCCGTGCT 300 149
for1 as above rev4 TCACCGCGCCTTGCTCGT 242 191
for2 as above rev4 as above 293 191
for3 as above rev4 as above 382 191
for7 as above rev4 as above 624 191
for5 as above rev4 as above 1126 191
for1 as above rev5 CCTCGGGCGTTTCGATCAC 323 272
for4 as above rev5 as above 541 272
for8 as above rev5 as above 878 272
for5 as above rev5 as above 1027 272
for8 CCAATGCATGTCGGCTCGC rev6 ACACCTCTTGCACGGAACCG 296 23**
for9 GACACAAGCCGCGAACTGAC rev7 CCCAATGTCCGACATAGCC 295 95**
for10 GAGCATCTTCGCGCCATAG rev8 TGTCGCGCTCGTTCGCTG 289 149**
for7 CCTTTGCCGTCAGCTTCCG rev9 TAGTAGCGGTGGCCCGAAG 301 201**
for11 CAGTTGTCCCTGAAGCGCCT rev10 TTGAGCAATGCGAGGCTGC 317 246**
  1. *Modified for asymmetrical (Linear-After-The-Exponential) PCR.
  2. **Probe set 2 – all other primer combinations for probe set 1.
\