Skip to main content

Table 1 Composition of three microsatellite PCR multiplexes developed for Zymoseptoria tritici population genetic studies

From: Development of a rapid multiplex SSR genotyping method to study populations of the fungal plant pathogen Zymoseptoria tritici

Multiplexa Chrom. Locusb Locus in literaturec Repeat motif of IPO-323d Primer sequences (5'- > 3') Fluores-cent dyee Size range (bp) Protein IDf Nag Neh Fnai Gene diversity (H E )j
          Total pop. (n = 166) Total pop. (n = 166) Total pop. (n = 166) Local pop. (n = 33) Worldwide pop. (n = 133)
Multiplex 1 (core chromosomes) 1 ST1 GAC0002 (GAC)6 F: AATCGACCCCTTCCTTCAAC Black 192-222 33894 3 1.4 0.6% 0.305 0.308
     R: GGGGGAGAGGCATAGTCTTG         
3 ST3A AG0003 (AG)15 F: ACTTGGGGAGGTGTTGTGAG Black 226-258 103950 16 5.8 2.4% 0.785 0.825
     R: ACGAATTGTTCATTCCAGCG         
4 ST4 AC0002 (AC)7 F: TGAACATCAACCTCACACGC Green 182-206 71387 7 2.0 0.0% 0.479 0.504
     R: AGAAGAGGACGACCCACGAG         
5 ST5 GGC0001 (GGC)8 F: GATACCAAGGTGGCCAAGG Green 232-256 104484 6 1.4 0.0% 0.114 0.345
     R: CACGTTGGGAGTGTCGAAG         
9 ST9 CT0004 (CT)6 F: CACCTCACTCCTCAATTCCG Green 336-348 62567 6 1.7 3.0% 0.404 0.413
     R: GAAAGGTTGGTGTCGTGTCC         
10 ST10 CAA0003 (CAA)7 F: TCCGTCATCAACAACACCAG Blue 139-160 62856 6 2.7 0% 0.624 0.631
     R: TGGCCGTAGAACTGCTGAG         
13 ST13 AG0009 (AG)10 (GGCA)3 F: GACTCCATTTACCTGTGGCG Blue 192-200 106529 5 2.4 0% 0.566 0.587
     R: TGTGAAGGACACGCAAAGAG         
11 ST11 GCA0002 (GCA)6 F: GTGTGAAACGAAAAGCGGAG Blue 293-296 - 2 1.1 17.5% 0.071 0.087
     R: TACTGGGTATCGAGATCGGC         
Multiplex 2 (core chromosomes) 8 ST8 CT0007 (CT)6 F: TGCAGGGCATTTAATTGAGG Black 180-188 61457 5 1.6 40.4% 0.322 0.404
     R: TCCATCCATTTAGGCTCGTC         
12 ST12 TCC0002 (TCC)6 F: GAATCCACCTCTTCCTTGCC Black 226-232 111480 3 1.1 5.4% 0.059 0.137
     R: AGGAGGATATCAAGGCCCAG         
3 ST3B CAA0005 (CAA)8 F: AAGAATCCCACCACCCAAAC Black 263-299 - 10 2.9 0.6% 0.663 0.648
     R: CACACGGCTCCTTTGACAC         
6 ST6 TCC0009 (TCC)8 F: TCAATTGCCAATAATTCGGG Green 161-179 73474 6 1.5 3.6% 0.242 0.342
     R: AGACGAGGCAGTTGGTTGAG         
3 ST3C GCA0003 (GCA)7 F: TCCTATCAACTCCCGAGACG Green 229-253 108534 5 2.2 1.2% 0.580 0.533
     R: CCGCACGTAGGAATTTTCAG         
2 ST2 Chr02-140 (GCT)12 F: ACACCAAAGAAGGATCCACG Green 338-365 108062 9 2.9 0% 0.439 0.689
     R: GCCGGAGGTCTATCAGTTTG         
11 ST1E7 ST1E7 (CGG)3 F: GATCTCGAGCAGGGCGGAAGT Blue 86-98 - 4 1.5 20.0% 0.204 0.373
     R: TCACACGCTGGTCTGTGAATC         
7 ST7 AC0001 (AC)21 F: CACCACACCGTCGTTCAAG Blue 171-227 105049 15 1.9 0.6% 0.463 0.487
     R: CGTAAGTTGGTGGAGATGGG         
Multiplex 3 (accessory chromosomes) 15 ST15 AC0007 (AC)15 F: TGCTCGCAAGACATAAAACG Black 92-152 106622 15 8.0 16.9% 0.858 0.885
     R: CTCTTAGCATTGGTCGGTGG         
21 ST21 GGA0001 (GGA)6 F: GTACGACACGGGCTATGGAG Black 149-161 111806 5 1.8 32.5% 0.632 0.640
     R: GGCGATGACGATGAAACC         
18 ST18 Chr18-007* (GGA)5 F: AGAGGCAATGGTGGGTGAT Black 245-272 111768 2 1.2 71.1% 0.411 0.430
     R: TCCTCCTCGTCCGACAATAC         
19 ST19 Chr19-031 (TCG)6 F: CTACTGTATTTCCCGGGGGT Black 351-363 97944 5 2.3 12.6% 0.700 0.631
     R: ACCCCTCTCTCCTTCTCTCG         
20 ST20 Chr20-066* (GAA)22 F: CTCCTCCACATCCATCCAAC Green 229-289 - 19 13.9 10.8% 0.891 0.914
     R: GACGGAGGGGGAGAGGTAT         
16 ST16 Chr16-016 (GAA)6 F: TTCACGGTATCACAGACCCA Green 496-538 97708 7 1.2 13.3% 0.369 0.364
     R: GGGTTGTCCAAGCTGTTGTT         
17 ST17 Chr17-040* (AGA)5 F: ACAAGAGGCGGAAGACTGAA Blue 236-239 97821 2 1.0 18.7% 0,367 0.311
     R: TCATGCGTCGTATTCTTGGA         
14 ST14 Chr14-023 (TCC)20 (TCG)5 F: CAAACAGCCAGATCCACCTT Blue 361-529 111734 36 12.1 13.8% 0.898 0.920
     R: GTCGTGGTCGGAGAGAGAAG         
  1. aPrimers for the housekeeping gene SOD are added in multiplexes 1 and 3 (green fluorescent dye; 96 bp amplicon; F:CTACCGATGCTCCAGCTGAGA and R:CACCACCCTTGCCATCCA), and primers from the housekeeping gene ILV5 are added in multiplexes 1 and 2 (black fluorescent dye; 108 bp amplicon; F:GCTCTATCGCCATCTTCCAGG and R:TCCTTCTCGAAGGTGGTCTTGT).
  2. bProposed name of microsatellite loci starting with the fungus initials and followed by the chromosome number on which the microsatellite is located (except for ST1E7).
  3. cLoci name found in the literature [20, 22] or in the Additional file 1 (primers for Chr18-007, Chr20-066 and Chr17-040 have been modified from the original design to fit the multiplex range size requirements).
  4. dRepeat motif of IPO-323 as published in [20, 22], with exception of ST7 and ST13, for which the motif was found slightly different after sequencing.
  5. ePrimers were purchased from Sigma Aldrich (France). They are WellRed oligos, licensed by Beckman Coulter (USA), and bearing fluorochromes at their 5’ end: D1: red, D2: black, D3: green, D4: blue.
  6. fIdentity number of the protein corresponding to SSR loci identified within expressed sequences (Filtered Gene Models from Mgraminicolav2 at JGI).
  7. gNumber of alleles identified in the total population (excluding null alleles).
  8. hEffective number of alleles (excluding null alleles).
  9. iFrequency of missing data or null alleles (no amplification) in the total population.
  10. jUnbiased gene diversity H E calculated as the probability that two individuals taken at random have different genotypes (excluding null alleles) [31].