Skip to main content

Table 2 Primers used in real-time qRT-PCR assays

From: Aneuploidy is permissive for hepatocyte-like cell differentiation from human induced pluripotent stem cells

  Probe Primer 1 Primer 2
APOA1 CTGCCAGAAATGCCGAGCCTG CTTTGAGCACATCCACGTACA GCCGTGCTCTTCCTGAC
APOB CTGGATACCGTGTATGGAAACTGCTCC CATTGCCCTTCCTCGTCTT CCAGAGACAGAAGAAGCCAAG
CPS1 TCCAGCAATCATTCCGGCCAAGA CCACAGGATTTAAGATACCCCAG GTAATTGTTCAGCCACACCAAG
CYP1A1 TCTGTGATGTCCCGGATGTGGC CCCAACCCTTCCCTGAATG TTCTTCTCCTGACAGTGCTCAATC
FGA CAGGCAGACGATCCTCATGGAAAACA CAGCCCCACCCTTAGAAAAG CTCCTTCAGCTAGAAAGTCACC
FGG AATAAGGGAGCTAAACAGAGCGGGC CAAAGACACGGTGCAAATCC TTCCAGACCCATCGATTTCAC
GSTA1 CGGGCTGACATTCATCTGGTGGA AAATCGCTACTTCCCTGCC GGAAGCTGGAGATAAGACTGG
HGD ATGCAGGCCACTCACAAAGTCTACTT AGCAAGCCATTGTTAGACTT CCTGATCCTAACCAGCTTAGATG
HNF1A CAGGTTGGTGGTGTCGGTGATGA GCCCTCTACAGCCACAAG CAGTGTCTGAGGTGAAGACC
HNF4A CAAGAAATGCTTCCGGGCTGGC ATAGCTTGACCTTCGAGTGC TGGACAAAGACAAGAGGAACC
LXR TGCATAGCTCGTTCCCCAGCATTT CCCTTCAGAACCCACAGAG CGCAGCTCAGAACATTGTAGT
RPL13A AGCAGTACCTGTTTAGCCACGATGG GCCTTCACAGCGTACGA CGAAGATGGCGGAGGTG
RXR AGTACTGCCGCTACCAGAAGTGC AGGACTGCCTGATTGACAAG GACTCCACCTCATTCTCGTTC
SERPINA1 TGGTGCCTGAAGCTGAGGAGAC AGCCAGGGAGACAGGGA CTTAAATACGGACGAGGACAGG
SLC10A1 AACCTCAGCATTGTGATGACCACCT TGTACAGGAGGAGAGGCATC ACCTGTCCAATGTCTTCAGTC
TF CTGTGTCAACTGTGTCCAGGGTGT TGAGCCACGTAAACCTCTTG AGTATTGGTTAAGGGTGGAGC
TTR AGCAGCCTAGCTCAGGAGAAGTGA CAGGTTTGCAGTCAGATTGG CCATCCTGCCAAGAATGAGT