Skip to main content

Table 5 Candidate reference and target genes, primers and amplicon sizes

From: Identification of appropriate reference genes for qPCR studies in Staphylococcus pseudintermedius and preliminary assessment of icaA gene expression in biofilm-embedded bacteria

Candidate reference genes Function Primer sequence (5’-3’) Expected size (bp)
proC Pyrrolidine-5-carboxylate reductase proC-F gccgaatacaaatgcgcacg 180
proC-R aaaaatgcagggccacttcc  
gyrB DNA gyrase B subunit gyrB-F gcgtccgttgattgaagcg 240
gyrB-R aacgtcacttgcaacatcgc  
rplD 50S ribosomal protein L4 rplD-F gcctaagaaaatgcgtcg 237
rplD-R ccttctggtgttgtgattg  
rho Transcription termination factor Rho rho-F cacgtaaaagttgctgaattg 215
rho-R cctgcttcgatatttctgg  
rpoA DNA-directed RNA polymerase sigma factor rpoA-F ctatcatcattaccaggtgc 231
rpoA-R caaaatttcaacatcactgtc  
ftsZ Cell division protein ftsZ ftsZ-F gtccattcagtttcgaagg 254
ftsZ-R catgattgttttaacgtcagc  
recA Recombinase A recA-F gcattaggtgtagatattgataac 228
recA-R ggctgcagaaagtttacgc  
sodA Superoxide dismutase sodA-F cgcaaacttagacagcgtacc 227
sodA-R caacaagccaagcccaacc  
Target Gene    
icaA N-acetylglucosaminyl-transferase icaA-F ttgcccaccttgtgcccacc 178
   icaA-R tgaggctgtagggcgttggga