Skip to main content

Table 2 PCR primers

From: Mapping of the chromosomal amplification 1p21-22 in bladder cancer

Gene Forward primer Reverse primer
DR1 TGCAAGAGTGTAAAAAGTAGCATT TGCTGCATTTGAAGCCATT
EVI5 AGCAGAGTGATGAGGCCAGT CTTCACTCAGTCGGGCTTG
RPL5 TGGAAGAAGATGAAGATGCTTAC GACGACATACCTCTTCTTTTTAACTTC
TMED5 TCACACCTTCCCTCGATAGC AAGGTTTTGCCTTCTGGAGAG
TBP GAATATAATCCCAAGCGGTTTG ACTTCACATCACAGCTCCCC