Skip to main content

Table 1 Characteristics and thermocycling conditions for 11 polymorphic microsatellites in the African leaf-nosed bat Hipposideros aff. ruber

From: Isolation and characterization of 11 novel microsatellite loci in a West African leaf-nosed bat, Hipposideros aff. ruber

Locus Accession # Repeat motif Primer sequences (5′ – 3′) MgCl2/PFR T a (°C) Size (bp) N NA HO HE HWE PNULL
Hr1 KM370156 (GATA)13 F:TGGCAAGGTTAACACGAACC 2.0 mM/0.5 μM 60-50 238-258 38 6 0.74 0.79 ns 0.028
Hr2 KM370157 (TCTT)15 F:GAAGCACTGCTGGAAAGGTT 2.0 mM/0.25 μM 60-50 311-339 34 8 0.77 0.76 ns -0.009
Hr5 KM370160 (GAAG)14 F:TGGGTGTTTCAGTTTCATGC 2.0 mM/0.5 μM 65-55 186-234 34 9 0.82 0.82 ns -0.006
Hr6 KM370161 (TCTT)13 F:GGGTTTCTTCAAATGTGTTTTC 2.0 mM/0.5 μM 55-47 204-240 37 8 0.70 0.73 ns 0.012
Hr7 KM370162 (ATTT)11 F:AGCCAATGACAAGACTGCCTA 2.0 mM/0.5 μM 65-55 144-172 33 8 0.42 0.68 *** 0.173
Hr8 KM370163 (ATCT)12 F:CTCAGCCCAAAGTCAAGGAG 2.0 mM/0.5 μM 60-50 221-241 36 6 0.72 0.68 ns -0.042
Hr9 KM370164 (TCTA)12 F:TGCTATCTTCCATGAGGTCAGA 2.0 mM/0.5 μM 60-50 218-234 38 5 0.63 0.73 ns 0.061
Hr10 KM370165 (TTAT)11 F:TCCACTGGAGTAAGAGATGTGTG 2.0 mM/1.0 μM 65-55 258-282 38 7 0.79 0.74 ns -0.040
Hr11 KM370166 (TTTC)14 F:CTCTTGCAATGAAGGCAATG 2.0 mM/0.5 μM 65-55 106-154 37 12 0.87 0.86 ns -0.018
Hr12 KM370167 (GATA)12 F:TTGGTTTTCAGATCTTCTGGTG 2.5 mM/0.5 μM 60-50 277-293 38 4 0.42 0.60 ** 0.140
Hr13 KM370168 (TTTC)13 F:CCGAAGCCAATCTGGTTTTA 2.0 mM/1.0 μM 65-55 321-329 34 2 0.00 0.06 ns 0.157
  1. PFR forward and reverse primer concentration, T a annealing temperatures of touchdown cycles (see Methods), N number of individuals, NA number of alleles, HO observed heterozygosity, HE expected heterozygosity, HWE probability of deviation from Hardy-Weinberg equilibrium, PNULL null allele frequency estimate (van Oosterhout), ns not significant., **p < 0.01, ***p < 0.001.