Skip to main content

Table 1 Primers used for PCR and quantitative PCR

From: Dietary Xylo-oligosaccharide stimulates intestinal bifidobacteria and lactobacilli but has limited effect on intestinal integrity in rats

Target

Primer

Primer sequence (5’-3’)

Size (bp)

Ref

Bifidobacterium spp.

BifF

GCGTGCTTAACACATGCAAGTC

126

[24]

BifR

CACCCGTTTCCAGGAGCTATT

 

Lactobacillus spp.

LactoAll_1F

AGCAGTAGGGAATCTTCCA

341

[25, 26]

LactoAll_1R

CACCGCTACACATGGAG

 

Akkermansia muciniphila

AM1

CAGCACGTGAAGGTGGGGAC

327

[27]

AM2

CCTTGCGGTTGGCTTCAGAT

 

Universal bacteria

HDA1

ACTCCTACGGGAGGCAGCAGT

200

[28]

HDA2

GTATTACCGCGGCTGCTGGCAC

 

Beta-actin (Actb)

ACTB_A

CACCCGCGA GTACAACCTT

207

[29]

ACTB_B

CCCATACCCACCATCACACC

 

Glyceraldehyd-3-phosphate (Gapdh)

GAPDH2_A

CAAGTTCAACGGCACAGTCAAG

123

[30]

GAPDH2_B

ACATACTCAGCACCAGCATCAC

 

Mucin 2 (Muc2)

MUC2_A

TCCCTCTTACAAGGGCAATG

123

[31]

MUC2_B

TTCCAGCTGTTCCCAAAGTC

 

Claudin-1

CLDN-1_A

TGTCCACCATTGGCATGAAG

118

[32]

CLDN-1_B

GCCACTAATGTCGCCAGACC

 

Occludin

OCLN_A

GCCTTTTGCTTCATCGCTTC

125

[30]

OCLN_B

AACACCATGATGCCCAGGAT

 

Zonula occludens-1 (ZO-1)

ZO-1_A

AAGCCAGTCACGATCTCCCG

106

[30]

ZO-1_B

GCGCTCTTCCTCTCTGCTCC