Skip to main content

Advertisement

Table 1 Primers used for PCR and quantitative PCR

From: Dietary Xylo-oligosaccharide stimulates intestinal bifidobacteria and lactobacilli but has limited effect on intestinal integrity in rats

Target Primer Primer sequence (5’-3’) Size (bp) Ref
Bifidobacterium spp. BifF GCGTGCTTAACACATGCAAGTC 126 [24]
BifR CACCCGTTTCCAGGAGCTATT  
Lactobacillus spp. LactoAll_1F AGCAGTAGGGAATCTTCCA 341 [25, 26]
LactoAll_1R CACCGCTACACATGGAG  
Akkermansia muciniphila AM1 CAGCACGTGAAGGTGGGGAC 327 [27]
AM2 CCTTGCGGTTGGCTTCAGAT  
Universal bacteria HDA1 ACTCCTACGGGAGGCAGCAGT 200 [28]
HDA2 GTATTACCGCGGCTGCTGGCAC  
Beta-actin (Actb) ACTB_A CACCCGCGA GTACAACCTT 207 [29]
ACTB_B CCCATACCCACCATCACACC  
Glyceraldehyd-3-phosphate (Gapdh) GAPDH2_A CAAGTTCAACGGCACAGTCAAG 123 [30]
GAPDH2_B ACATACTCAGCACCAGCATCAC  
Mucin 2 (Muc2) MUC2_A TCCCTCTTACAAGGGCAATG 123 [31]
MUC2_B TTCCAGCTGTTCCCAAAGTC  
Claudin-1 CLDN-1_A TGTCCACCATTGGCATGAAG 118 [32]
CLDN-1_B GCCACTAATGTCGCCAGACC  
Occludin OCLN_A GCCTTTTGCTTCATCGCTTC 125 [30]
OCLN_B AACACCATGATGCCCAGGAT  
Zonula occludens-1 (ZO-1) ZO-1_A AAGCCAGTCACGATCTCCCG 106 [30]
ZO-1_B GCGCTCTTCCTCTCTGCTCC