Skip to main content

Table 1 Primers used for PCR and quantitative PCR

From: Dietary Xylo-oligosaccharide stimulates intestinal bifidobacteria and lactobacilli but has limited effect on intestinal integrity in rats

Target Primer Primer sequence (5’-3’) Size (bp) Ref
Bifidobacterium spp. BifF GCGTGCTTAACACATGCAAGTC 126 [24]
Lactobacillus spp. LactoAll_1F AGCAGTAGGGAATCTTCCA 341 [25, 26]
Akkermansia muciniphila AM1 CAGCACGTGAAGGTGGGGAC 327 [27]
Universal bacteria HDA1 ACTCCTACGGGAGGCAGCAGT 200 [28]
Beta-actin (Actb) ACTB_A CACCCGCGA GTACAACCTT 207 [29]
Glyceraldehyd-3-phosphate (Gapdh) GAPDH2_A CAAGTTCAACGGCACAGTCAAG 123 [30]
Zonula occludens-1 (ZO-1) ZO-1_A AAGCCAGTCACGATCTCCCG 106 [30]