Skip to main content

Table 1 Primers used in this study

From: Co-existence of beta-lactamases in clinical isolates of Escherichia coli from Kathmandu, Nepal

Name of the primer Target Amplicon (bp) Sequence 5′-3′
TEM1F bla TEM 864 ATGAGTATTCAACATTTCCG
TEM1R CTGACAGTTACCAATGCTTA
SHVF bla SHV 865 GGTTATGCGTTATATTCGCC
SHVR TTAGCGTTGCCAGTGCTC
CTX-MA1 bla CTX-M 544 *SCSATGTGCAGYACCAGTAA
CTX-MA2 CCGC¥RATATGRTTGGTGGTG
IMP F bla IMP 569 TTGCCAGATTTAAAAAT
IMP 003 ACCAGTTTTGCCTTACCATA
VIM F bla VIM 551 GTCTACCCGTCCAATGGTCTCA
VIM R AGCAAGTCTAGACCGCCCG
NDM-1 F bla NDM-1 593 GGTTTGGCGATCTGGTTTTC
NDM-1 R CGGAATGGCTCATCACGATC
IntI1F intI1 471 AAGGATCGGGCCTTGATGTT
IntI1R    CAGCGCATCAAGCGGTGAGC
  1. Note: *S = G or C, Y = C or T, ¥R = A or T.